Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1119286482:

Variant ID: vg1119286482 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19286482
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGATGTTGCATGCTTGCATAAGTTTTGTACTCCCTCCGGGCTGATAATACTTGTCGTTTTAGACAAGGGTGAAGTCAAACTTTAGAATCTTTGATTAT[G/T]
AATCATTTTTAAAATATTTGTCTTTCAAATATGGTGACTACATGTATAGATTAGTCTTAAAAAATACTTTAATAAAATCATATATCTGTTAACACTTTTA

Reverse complement sequence

TAAAAGTGTTAACAGATATATGATTTTATTAAAGTATTTTTTAAGACTAATCTATACATGTAGTCACCATATTTGAAAGACAAATATTTTAAAAATGATT[C/A]
ATAATCAAAGATTCTAAAGTTTGACTTCACCCTTGTCTAAAACGACAAGTATTATCAGCCCGGAGGGAGTACAAAACTTATGCAAGCATGCAACATCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	9.60%	1.38%	0.36%	NA
All Indica	2759	84.10%	14.20%	1.12%	0.62%	NA
All Japonica	1512	96.60%	1.30%	2.12%	0.00%	NA
Aus	269	84.40%	14.90%	0.74%	0.00%	NA
Indica I	595	78.70%	20.20%	1.18%	0.00%	NA
Indica II	465	94.80%	3.90%	0.00%	1.29%	NA
Indica III	913	81.70%	16.80%	0.99%	0.55%	NA
Indica Intermediate	786	84.50%	12.80%	1.91%	0.76%	NA
Temperate Japonica	767	97.40%	2.60%	0.00%	0.00%	NA
Tropical Japonica	504	93.70%	0.00%	6.35%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119286482	G -> T	LOC_Os11g32660.1	upstream_gene_variant ; 1881.0bp to feature; MODIFIER	silent_mutation	Average:35.525; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg1119286482	G -> T	LOC_Os11g32650-LOC_Os11g32660	intergenic_region ; MODIFIER	silent_mutation	Average:35.525; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg1119286482	G -> DEL	N	N	silent_mutation	Average:35.525; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119286482	8.03E-06	NA	mr1911	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251