\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119258661:

Variant ID: vg1119258661 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19258661
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, A: 0.10, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGATGACATTCTTCAAGAATGATCTATCTCTTCTTGTTTATTGTTTAAGATTAGATGAGAGATCAGCTTTCTGTTCCTGGTTAAATCACTTGTAATTT[C/A]
TGTATATATTTTTCTTAATAAAATTATTTAACTGTGGGGGCTTCCTCTACAGTGCTTTCCCTAAAAGAAATAGTAAAAGGGTAGTTCCTCCTCCATTGTA

Reverse complement sequence

TACAATGGAGGAGGAACTACCCTTTTACTATTTCTTTTAGGGAAAGCACTGTAGAGGAAGCCCCCACAGTTAAATAATTTTATTAAGAAAAATATATACA[G/T]
AAATTACAAGTGATTTAACCAGGAACAGAAAGCTGATCTCTCATCTAATCTTAAACAATAAACAAGAAGAGATAGATCATTCTTGAAGAATGTCATCCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 33.30% 0.30% 0.00% NA
All Indica  2759 51.30% 48.20% 0.47% 0.00% NA
All Japonica  1512 97.00% 3.00% 0.00% 0.00% NA
Aus  269 38.30% 61.70% 0.00% 0.00% NA
Indica I  595 89.20% 10.60% 0.17% 0.00% NA
Indica II  465 37.20% 61.90% 0.86% 0.00% NA
Indica III  913 34.80% 64.60% 0.55% 0.00% NA
Indica Intermediate  786 50.10% 49.50% 0.38% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 90.90% 9.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119258661 C -> A LOC_Os11g32640.1 downstream_gene_variant ; 4844.0bp to feature; MODIFIER silent_mutation Average:30.441; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg1119258661 C -> A LOC_Os11g32630-LOC_Os11g32640 intergenic_region ; MODIFIER silent_mutation Average:30.441; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119258661 NA 2.79E-08 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 7.19E-06 mr1318 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 3.73E-07 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 3.22E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 7.95E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 9.41E-06 mr1668 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 3.17E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 4.37E-09 mr1729 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 5.75E-07 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 1.25E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 5.79E-06 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119258661 NA 7.19E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251