\
| Variant ID: vg1119255268 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19255268 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCACGAGGTCCTCGGAGCCAAACGAGGGCGCACGAACGCGGTGAAAACATGGGCCCCACCCCCCTCTCTCCTCACGCACGCAATCTGCTTACGTGGATAG[A/G]
CATTGCCACACGTGAGTCACGTGTGTGCACCGTGAATGCCCTAAGAGGTACTCCCCCGTTCCATTTTAAGTGCAGTTATGGGTTTGTGTCCAACGTTTGA
TCAAACGTTGGACACAAACCCATAACTGCACTTAAAATGGAACGGGGGAGTACCTCTTAGGGCATTCACGGTGCACACACGTGACTCACGTGTGGCAATG[T/C]
CTATCCACGTAAGCAGATTGCGTGCGTGAGGAGAGAGGGGGGTGGGGCCCATGTTTTCACCGCGTTCGTGCGCCCTCGTTTGGCTCCGAGGACCTCGTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.10% | 1.50% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 96.70% | 2.50% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 89.00% | 8.20% | 2.80% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 2.80% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119255268 | A -> G | LOC_Os11g32630-LOC_Os11g32640 | intergenic_region ; MODIFIER | silent_mutation | Average:70.34; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119255268 | NA | 1.50E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119255268 | NA | 6.10E-06 | mr1297 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119255268 | NA | 2.94E-06 | mr1372 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119255268 | NA | 4.50E-06 | mr1432 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119255268 | 4.41E-08 | 4.41E-08 | mr1465 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119255268 | NA | 8.24E-06 | mr1537 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119255268 | NA | 3.00E-06 | mr1928 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119255268 | NA | 6.62E-06 | mr1943 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119255268 | NA | 2.68E-07 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119255268 | NA | 2.27E-07 | mr1958 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |