Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119228700:

Variant ID: vg1119228700 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19228700
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TTAATTGGCTCCAATCTGCCAACGACCATGAGCTAGCTTAGCATGCAAACGAGCTGCATTGCATGCTAGATTTCGCATGATTCATGCTAATATTGGCATG[G/A]
TGTTTTACTGATATTACACATGTTGCAACAGATTGAAAGAGCGGAATTAGAGATTTCAGCATATGTGCTCGATCAGCAGCGGACAGATTTAAGCATCGTT

Reverse complement sequence

AACGATGCTTAAATCTGTCCGCTGCTGATCGAGCACATATGCTGAAATCTCTAATTCCGCTCTTTCAATCTGTTGCAACATGTGTAATATCAGTAAAACA[C/T]
CATGCCAATATTAGCATGAATCATGCGAAATCTAGCATGCAATGCAGCTCGTTTGCATGCTAAGCTAGCTCATGGTCGTTGGCAGATTGGAGCCAATTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.50%	26.20%	0.11%	0.13%	NA
All Indica	2759	58.30%	41.50%	0.11%	0.14%	NA
All Japonica	1512	98.30%	1.60%	0.07%	0.07%	NA
Aus	269	82.50%	17.50%	0.00%	0.00%	NA
Indica I	595	96.50%	3.40%	0.00%	0.17%	NA
Indica II	465	36.60%	62.80%	0.00%	0.65%	NA
Indica III	913	45.20%	54.70%	0.11%	0.00%	NA
Indica Intermediate	786	57.40%	42.40%	0.25%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	97.40%	2.20%	0.20%	0.20%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	72.20%	25.60%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119228700	G -> A	LOC_Os11g32580.1	upstream_gene_variant ; 201.0bp to feature; MODIFIER	silent_mutation	Average:51.107; most accessible tissue: Callus, score: 80.025	N	N	N	N
vg1119228700	G -> A	LOC_Os11g32590.1	upstream_gene_variant ; 1857.0bp to feature; MODIFIER	silent_mutation	Average:51.107; most accessible tissue: Callus, score: 80.025	N	N	N	N
vg1119228700	G -> A	LOC_Os11g32600.1	downstream_gene_variant ; 3761.0bp to feature; MODIFIER	silent_mutation	Average:51.107; most accessible tissue: Callus, score: 80.025	N	N	N	N
vg1119228700	G -> A	LOC_Os11g32580-LOC_Os11g32590	intergenic_region ; MODIFIER	silent_mutation	Average:51.107; most accessible tissue: Callus, score: 80.025	N	N	N	N
vg1119228700	G -> DEL	N	N	silent_mutation	Average:51.107; most accessible tissue: Callus, score: 80.025	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119228700	NA	7.32E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	4.05E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	1.84E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	3.77E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	3.12E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	7.31E-07	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	5.99E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	1.65E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	9.14E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	1.86E-09	mr1668	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	7.77E-06	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	4.02E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	5.18E-08	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	4.30E-08	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	8.66E-06	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	1.62E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119228700	NA	2.27E-06	mr1984	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251