Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119207316:

Variant ID: vg1119207316 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19207316
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GATAAGCACTTGCTGAACATCTTTATATTCCCTCCTAAGTTTTTTTCAGTTCACAGTTGCTTAGTTCCCTGTCTCACGTATATTTATAGACAACGTTCCG[C/T]
ATCAAACGTGCGGTGTATCATCTAGTATATACATGTATTTCAAAGTTCTCAAATATTTTATTAGACCTCATGTTTCAAAAATGTATCCTCTCGTTTGTAC

Reverse complement sequence

GTACAAACGAGAGGATACATTTTTGAAACATGAGGTCTAATAAAATATTTGAGAACTTTGAAATACATGTATATACTAGATGATACACCGCACGTTTGAT[G/A]
CGGAACGTTGTCTATAAATATACGTGAGACAGGGAACTAAGCAACTGTGAACTGAAAAAAACTTAGGAGGGAATATAAAGATGTTCAGCAAGTGCTTATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.80%	26.00%	3.87%	21.31%	NA
All Indica	2759	28.50%	41.00%	4.20%	26.28%	NA
All Japonica	1512	91.60%	1.60%	0.20%	6.61%	NA
Aus	269	3.70%	17.80%	18.22%	60.22%	NA
Indica I	595	63.90%	3.40%	1.34%	31.43%	NA
Indica II	465	24.70%	61.90%	6.24%	7.10%	NA
Indica III	913	10.10%	54.00%	3.29%	32.64%	NA
Indica Intermediate	786	25.30%	42.10%	6.23%	26.34%	NA
Temperate Japonica	767	96.10%	1.20%	0.00%	2.74%	NA
Tropical Japonica	504	87.30%	2.40%	0.40%	9.92%	NA
Japonica Intermediate	241	86.30%	1.20%	0.41%	12.03%	NA
VI/Aromatic	96	80.20%	2.10%	10.42%	7.29%	NA
Intermediate	90	53.30%	26.70%	5.56%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119207316	C -> T	LOC_Os11g32540.1	downstream_gene_variant ; 381.0bp to feature; MODIFIER	silent_mutation	Average:43.155; most accessible tissue: Callus, score: 70.187	N	N	N	N
vg1119207316	C -> T	LOC_Os11g32550.1	downstream_gene_variant ; 3926.0bp to feature; MODIFIER	silent_mutation	Average:43.155; most accessible tissue: Callus, score: 70.187	N	N	N	N
vg1119207316	C -> T	LOC_Os11g32530-LOC_Os11g32540	intergenic_region ; MODIFIER	silent_mutation	Average:43.155; most accessible tissue: Callus, score: 70.187	N	N	N	N
vg1119207316	C -> DEL	N	N	silent_mutation	Average:43.155; most accessible tissue: Callus, score: 70.187	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119207316	NA	1.21E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	4.99E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	1.65E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	6.63E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	2.58E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	1.20E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	3.66E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	1.56E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	4.38E-09	mr1668	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	3.20E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	1.20E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	6.64E-09	mr1958	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	8.60E-06	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	4.68E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	3.95E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119207316	NA	2.74E-06	mr1984	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251