\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119206802:

Variant ID: vg1119206802 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19206802
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCTATATACTTATCTGTTAAACCTATATAATTGATCCACTTTATGTAGTTATTACTATTTTGCTTTGCTGTGGTTGTTTTACGTCACCTAAAATATTT[T/A]
CCACCGTTTGATTGTTTGATTAGAAACTTTGCAGGGATAATTTCATCTGTTCTCCTGGAAAAAAAAGTGTGCAGCAGTACATATTGAGGTAAAATCAATG

Reverse complement sequence

CATTGATTTTACCTCAATATGTACTGCTGCACACTTTTTTTTCCAGGAGAACAGATGAAATTATCCCTGCAAAGTTTCTAATCAAACAATCAAACGGTGG[A/T]
AAATATTTTAGGTGACGTAAAACAACCACAGCAAAGCAAAATAGTAATAACTACATAAAGTGGATCAATTATATAGGTTTAACAGATAAGTATATAGGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 26.00% 0.02% 0.00% NA
All Indica  2759 59.00% 41.00% 0.04% 0.00% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 82.20% 17.80% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 38.10% 61.90% 0.00% 0.00% NA
Indica III  913 46.00% 53.90% 0.11% 0.00% NA
Indica Intermediate  786 57.90% 42.10% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119206802 T -> A LOC_Os11g32540.1 downstream_gene_variant ; 895.0bp to feature; MODIFIER silent_mutation Average:41.735; most accessible tissue: Callus, score: 68.807 N N N N
vg1119206802 T -> A LOC_Os11g32550.1 downstream_gene_variant ; 4440.0bp to feature; MODIFIER silent_mutation Average:41.735; most accessible tissue: Callus, score: 68.807 N N N N
vg1119206802 T -> A LOC_Os11g32530-LOC_Os11g32540 intergenic_region ; MODIFIER silent_mutation Average:41.735; most accessible tissue: Callus, score: 68.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119206802 NA 8.91E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 1.37E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 9.19E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 5.25E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 9.54E-07 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 6.43E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 4.09E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 9.57E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 1.53E-09 mr1668 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 8.04E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 5.44E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 2.02E-07 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 1.20E-07 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 2.42E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119206802 NA 2.12E-06 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251