\
| Variant ID: vg1119206802 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19206802 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.00, others allele: 0.00, population size: 236. )
ATCCTATATACTTATCTGTTAAACCTATATAATTGATCCACTTTATGTAGTTATTACTATTTTGCTTTGCTGTGGTTGTTTTACGTCACCTAAAATATTT[T/A]
CCACCGTTTGATTGTTTGATTAGAAACTTTGCAGGGATAATTTCATCTGTTCTCCTGGAAAAAAAAGTGTGCAGCAGTACATATTGAGGTAAAATCAATG
CATTGATTTTACCTCAATATGTACTGCTGCACACTTTTTTTTCCAGGAGAACAGATGAAATTATCCCTGCAAAGTTTCTAATCAAACAATCAAACGGTGG[A/T]
AAATATTTTAGGTGACGTAAAACAACCACAGCAAAGCAAAATAGTAATAACTACATAAAGTGGATCAATTATATAGGTTTAACAGATAAGTATATAGGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.00% | 26.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 59.00% | 41.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 38.10% | 61.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 46.00% | 53.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 57.90% | 42.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119206802 | T -> A | LOC_Os11g32540.1 | downstream_gene_variant ; 895.0bp to feature; MODIFIER | silent_mutation | Average:41.735; most accessible tissue: Callus, score: 68.807 | N | N | N | N |
| vg1119206802 | T -> A | LOC_Os11g32550.1 | downstream_gene_variant ; 4440.0bp to feature; MODIFIER | silent_mutation | Average:41.735; most accessible tissue: Callus, score: 68.807 | N | N | N | N |
| vg1119206802 | T -> A | LOC_Os11g32530-LOC_Os11g32540 | intergenic_region ; MODIFIER | silent_mutation | Average:41.735; most accessible tissue: Callus, score: 68.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119206802 | NA | 8.91E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 1.37E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 9.19E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 5.25E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 9.54E-07 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 6.43E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 4.09E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 9.57E-06 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 1.53E-09 | mr1668 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 8.04E-06 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 5.44E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 2.02E-07 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 1.20E-07 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 2.42E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119206802 | NA | 2.12E-06 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |