\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119202979:

Variant ID: vg1119202979 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19202979
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCACGACACGGCAGGATTAAGGTTTCCATCAACGATATATTTACAAACGAAAAATAATCTGTGAATAAAATTTTAGAGTAAAATCTATCACCGGTCA[T/C]
TAAACTTGTATCGTTGTGTCATCCCGGTCGCTAAACTCGCAAATCGACCGTTTAGGTTCGACTGTGTCATCCCGGTCCCTAAACTTACAGATCACTCATT

Reverse complement sequence

AATGAGTGATCTGTAAGTTTAGGGACCGGGATGACACAGTCGAACCTAAACGGTCGATTTGCGAGTTTAGCGACCGGGATGACACAACGATACAAGTTTA[A/G]
TGACCGGTGATAGATTTTACTCTAAAATTTTATTCACAGATTATTTTTCGTTTGTAAATATATCGTTGATGGAAACCTTAATCCTGCCGTGTCGTGGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 44.70% 1.90% 5.08% NA
All Indica  2759 28.10% 60.80% 2.86% 8.23% NA
All Japonica  1512 91.50% 8.20% 0.07% 0.26% NA
Aus  269 1.10% 96.30% 0.74% 1.86% NA
Indica I  595 63.40% 34.60% 0.17% 1.85% NA
Indica II  465 25.20% 55.10% 9.25% 10.54% NA
Indica III  913 9.40% 80.40% 1.31% 8.87% NA
Indica Intermediate  786 24.90% 61.20% 2.93% 10.94% NA
Temperate Japonica  767 96.10% 3.70% 0.00% 0.26% NA
Tropical Japonica  504 87.30% 12.10% 0.20% 0.40% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 50.00% 36.70% 8.89% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119202979 T -> DEL N N silent_mutation Average:41.391; most accessible tissue: Callus, score: 90.075 N N N N
vg1119202979 T -> C LOC_Os11g32530.1 downstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:41.391; most accessible tissue: Callus, score: 90.075 N N N N
vg1119202979 T -> C LOC_Os11g32540.1 downstream_gene_variant ; 4718.0bp to feature; MODIFIER silent_mutation Average:41.391; most accessible tissue: Callus, score: 90.075 N N N N
vg1119202979 T -> C LOC_Os11g32530-LOC_Os11g32540 intergenic_region ; MODIFIER silent_mutation Average:41.391; most accessible tissue: Callus, score: 90.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119202979 NA 2.96E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 NA 6.95E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 NA 2.73E-07 mr1375 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 4.53E-06 4.53E-06 mr1463 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 NA 4.14E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 NA 9.36E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 NA 1.06E-07 mr1668 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 NA 1.65E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 NA 2.32E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 3.40E-06 3.40E-06 mr1809 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 3.98E-06 3.98E-06 mr1814 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 8.01E-06 7.21E-08 mr1837 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 NA 1.05E-06 mr1844 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202979 NA 9.92E-07 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251