Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119202978:

Variant ID: vg1119202978 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19202978
Reference Allele: A	Alternative Allele: C,T
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

GATTCCACGACACGGCAGGATTAAGGTTTCCATCAACGATATATTTACAAACGAAAAATAATCTGTGAATAAAATTTTAGAGTAAAATCTATCACCGGTC[A/C,T]
TTAAACTTGTATCGTTGTGTCATCCCGGTCGCTAAACTCGCAAATCGACCGTTTAGGTTCGACTGTGTCATCCCGGTCCCTAAACTTACAGATCACTCAT

Reverse complement sequence

ATGAGTGATCTGTAAGTTTAGGGACCGGGATGACACAGTCGAACCTAAACGGTCGATTTGCGAGTTTAGCGACCGGGATGACACAACGATACAAGTTTAA[T/G,A]
GACCGGTGATAGATTTTACTCTAAAATTTTATTCACAGATTATTTTTCGTTTGTAAATATATCGTTGATGGAAACCTTAATCCTGCCGTGTCGTGGAATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	44.50%	1.99%	5.08%	T: 0.17%
All Indica	2759	28.10%	60.50%	2.97%	8.23%	T: 0.18%
All Japonica	1512	91.50%	8.10%	0.13%	0.26%	T: 0.07%
Aus	269	1.10%	96.30%	0.74%	1.86%	NA
Indica I	595	63.40%	34.60%	0.17%	1.85%	NA
Indica II	465	25.20%	54.80%	9.46%	10.54%	NA
Indica III	913	9.40%	80.00%	1.42%	8.87%	T: 0.33%
Indica Intermediate	786	24.90%	60.80%	3.05%	10.94%	T: 0.25%
Temperate Japonica	767	96.10%	3.70%	0.00%	0.26%	NA
Tropical Japonica	504	87.30%	11.70%	0.40%	0.40%	T: 0.20%
Japonica Intermediate	241	85.50%	14.50%	0.00%	0.00%	NA
VI/Aromatic	96	79.20%	20.80%	0.00%	0.00%	NA
Intermediate	90	50.00%	34.40%	8.89%	4.44%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119202978	A -> T	LOC_Os11g32530.1	downstream_gene_variant ; 2394.0bp to feature; MODIFIER	silent_mutation	Average:41.864; most accessible tissue: Callus, score: 90.075	N	N	N	N
vg1119202978	A -> T	LOC_Os11g32540.1	downstream_gene_variant ; 4719.0bp to feature; MODIFIER	silent_mutation	Average:41.864; most accessible tissue: Callus, score: 90.075	N	N	N	N
vg1119202978	A -> T	LOC_Os11g32530-LOC_Os11g32540	intergenic_region ; MODIFIER	silent_mutation	Average:41.864; most accessible tissue: Callus, score: 90.075	N	N	N	N
vg1119202978	A -> DEL	N	N	silent_mutation	Average:41.864; most accessible tissue: Callus, score: 90.075	N	N	N	N
vg1119202978	A -> C	LOC_Os11g32530.1	downstream_gene_variant ; 2394.0bp to feature; MODIFIER	silent_mutation	Average:41.864; most accessible tissue: Callus, score: 90.075	N	N	N	N
vg1119202978	A -> C	LOC_Os11g32540.1	downstream_gene_variant ; 4719.0bp to feature; MODIFIER	silent_mutation	Average:41.864; most accessible tissue: Callus, score: 90.075	N	N	N	N
vg1119202978	A -> C	LOC_Os11g32530-LOC_Os11g32540	intergenic_region ; MODIFIER	silent_mutation	Average:41.864; most accessible tissue: Callus, score: 90.075	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119202978	NA	1.76E-06	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	6.99E-06	mr1252	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	8.71E-06	mr1285	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	8.77E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	7.20E-08	mr1375	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	3.34E-06	3.34E-06	mr1463	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	2.81E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	3.03E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	7.81E-06	2.69E-08	mr1668	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	6.14E-07	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	2.79E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	6.89E-06	6.89E-06	mr1809	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	9.76E-06	9.76E-06	mr1814	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	9.57E-06	9.80E-08	mr1837	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	2.32E-06	mr1844	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978	NA	1.13E-06	mr1956	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251