\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119202978:

Variant ID: vg1119202978 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19202978
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


GATTCCACGACACGGCAGGATTAAGGTTTCCATCAACGATATATTTACAAACGAAAAATAATCTGTGAATAAAATTTTAGAGTAAAATCTATCACCGGTC[A/C,T]
TTAAACTTGTATCGTTGTGTCATCCCGGTCGCTAAACTCGCAAATCGACCGTTTAGGTTCGACTGTGTCATCCCGGTCCCTAAACTTACAGATCACTCAT

Reverse complement sequence

ATGAGTGATCTGTAAGTTTAGGGACCGGGATGACACAGTCGAACCTAAACGGTCGATTTGCGAGTTTAGCGACCGGGATGACACAACGATACAAGTTTAA[T/G,A]
GACCGGTGATAGATTTTACTCTAAAATTTTATTCACAGATTATTTTTCGTTTGTAAATATATCGTTGATGGAAACCTTAATCCTGCCGTGTCGTGGAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 44.50% 1.99% 5.08% T: 0.17%
All Indica  2759 28.10% 60.50% 2.97% 8.23% T: 0.18%
All Japonica  1512 91.50% 8.10% 0.13% 0.26% T: 0.07%
Aus  269 1.10% 96.30% 0.74% 1.86% NA
Indica I  595 63.40% 34.60% 0.17% 1.85% NA
Indica II  465 25.20% 54.80% 9.46% 10.54% NA
Indica III  913 9.40% 80.00% 1.42% 8.87% T: 0.33%
Indica Intermediate  786 24.90% 60.80% 3.05% 10.94% T: 0.25%
Temperate Japonica  767 96.10% 3.70% 0.00% 0.26% NA
Tropical Japonica  504 87.30% 11.70% 0.40% 0.40% T: 0.20%
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 50.00% 34.40% 8.89% 4.44% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119202978 A -> T LOC_Os11g32530.1 downstream_gene_variant ; 2394.0bp to feature; MODIFIER silent_mutation Average:41.864; most accessible tissue: Callus, score: 90.075 N N N N
vg1119202978 A -> T LOC_Os11g32540.1 downstream_gene_variant ; 4719.0bp to feature; MODIFIER silent_mutation Average:41.864; most accessible tissue: Callus, score: 90.075 N N N N
vg1119202978 A -> T LOC_Os11g32530-LOC_Os11g32540 intergenic_region ; MODIFIER silent_mutation Average:41.864; most accessible tissue: Callus, score: 90.075 N N N N
vg1119202978 A -> DEL N N silent_mutation Average:41.864; most accessible tissue: Callus, score: 90.075 N N N N
vg1119202978 A -> C LOC_Os11g32530.1 downstream_gene_variant ; 2394.0bp to feature; MODIFIER silent_mutation Average:41.864; most accessible tissue: Callus, score: 90.075 N N N N
vg1119202978 A -> C LOC_Os11g32540.1 downstream_gene_variant ; 4719.0bp to feature; MODIFIER silent_mutation Average:41.864; most accessible tissue: Callus, score: 90.075 N N N N
vg1119202978 A -> C LOC_Os11g32530-LOC_Os11g32540 intergenic_region ; MODIFIER silent_mutation Average:41.864; most accessible tissue: Callus, score: 90.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119202978 NA 1.76E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 6.99E-06 mr1252 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 8.71E-06 mr1285 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 8.77E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 7.20E-08 mr1375 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 3.34E-06 3.34E-06 mr1463 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 2.81E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 3.03E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 7.81E-06 2.69E-08 mr1668 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 6.14E-07 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 2.79E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 6.89E-06 6.89E-06 mr1809 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 9.76E-06 9.76E-06 mr1814 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 9.57E-06 9.80E-08 mr1837 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 2.32E-06 mr1844 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119202978 NA 1.13E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251