\
| Variant ID: vg1119170327 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 19170327 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 209. )
TTATGATGATGCTTGGATCCTCATGTGTTAGTTTTGCTTTTCTCATATGTGTAGTCGGTATTATTCATATTAGAAAGCATATTATTCAGTGTTTACAGTA[T/C]
CTGTTTAGCAGGAAGCACCTTCATTTTGAAATATTTAAATTCAACATTTTGCTGCCCCTATATTTGTTACTTGTTCTTTTCCTTTCTCATGTTGAAGTGT
ACACTTCAACATGAGAAAGGAAAAGAACAAGTAACAAATATAGGGGCAGCAAAATGTTGAATTTAAATATTTCAAAATGAAGGTGCTTCCTGCTAAACAG[A/G]
TACTGTAAACACTGAATAATATGCTTTCTAATATGAATAATACCGACTACACATATGAGAAAAGCAAAACTAACACATGAGGATCCAAGCATCATCATAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 49.60% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 27.20% | 72.20% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 91.60% | 8.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.50% | 41.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 9.50% | 90.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 16.50% | 82.90% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 26.50% | 72.50% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.30% | 12.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 16.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1119170327 | T -> C | LOC_Os11g32480.1 | upstream_gene_variant ; 2561.0bp to feature; MODIFIER | silent_mutation | Average:49.967; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg1119170327 | T -> C | LOC_Os11g32490.1 | downstream_gene_variant ; 4822.0bp to feature; MODIFIER | silent_mutation | Average:49.967; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg1119170327 | T -> C | LOC_Os11g32470.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.967; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1119170327 | NA | 4.22E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119170327 | 3.56E-07 | 3.56E-07 | mr1655 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119170327 | NA | 2.03E-06 | mr1712 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119170327 | 4.74E-07 | 4.74E-07 | mr1770 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119170327 | NA | 2.68E-06 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119170327 | 3.00E-06 | 3.00E-06 | mr1910 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1119170327 | NA | 8.40E-10 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |