Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119100956:

Variant ID: vg1119100956 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19100956
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAGAGAGATGGGTTAGCTTCAACATGAGTGTTTTTAGAACATTTAAAAAAGATGATGTGGCATATAAAGGGATAAGTTGATTTCTGTTATTTACTGAT[G/A]
CCTTTTCTTAAAAAGTGACTTAGCGGCTGGTTAAAAGGTGGCTTAGCGGCTGGGGAGCAAATAAGGTTAGTAAGTTCAGGGAAAAAAAGTAAGGTGTTAG

Reverse complement sequence

CTAACACCTTACTTTTTTTCCCTGAACTTACTAACCTTATTTGCTCCCCAGCCGCTAAGCCACCTTTTAACCAGCCGCTAAGTCACTTTTTAAGAAAAGG[C/T]
ATCAGTAAATAACAGAAATCAACTTATCCCTTTATATGCCACATCATCTTTTTTAAATGTTCTAAAAACACTCATGTTGAAGCTAACCCATCTCTCTCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.10%	2.00%	0.87%	0.00%	NA
All Indica	2759	95.20%	3.40%	1.41%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	0.00%	1.51%	0.00%	NA
Indica II	465	87.30%	8.80%	3.87%	0.00%	NA
Indica III	913	96.80%	2.80%	0.33%	0.00%	NA
Indica Intermediate	786	95.50%	3.30%	1.15%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119100956	G -> A	LOC_Os11g32330.1	downstream_gene_variant ; 2495.0bp to feature; MODIFIER	silent_mutation	Average:40.068; most accessible tissue: Zhenshan97 young leaf, score: 61.386	N	N	N	N
vg1119100956	G -> A	LOC_Os11g32340.1	downstream_gene_variant ; 3278.0bp to feature; MODIFIER	silent_mutation	Average:40.068; most accessible tissue: Zhenshan97 young leaf, score: 61.386	N	N	N	N
vg1119100956	G -> A	LOC_Os11g32330-LOC_Os11g32340	intergenic_region ; MODIFIER	silent_mutation	Average:40.068; most accessible tissue: Zhenshan97 young leaf, score: 61.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119100956	4.96E-06	4.96E-06	mr1054	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	NA	7.64E-06	mr1060	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	NA	2.63E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	1.07E-06	1.07E-06	mr1287	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	NA	2.30E-06	mr1297	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	4.67E-06	1.43E-07	mr1372	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	NA	1.37E-06	mr1432	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	NA	1.38E-06	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	8.23E-06	8.23E-06	mr1724	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	NA	4.57E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	NA	9.84E-09	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	NA	5.88E-06	mr1956	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	3.17E-06	5.73E-09	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956	2.88E-06	2.88E-06	mr1972	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251