\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119100956:

Variant ID: vg1119100956 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19100956
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAGAGAGATGGGTTAGCTTCAACATGAGTGTTTTTAGAACATTTAAAAAAGATGATGTGGCATATAAAGGGATAAGTTGATTTCTGTTATTTACTGAT[G/A]
CCTTTTCTTAAAAAGTGACTTAGCGGCTGGTTAAAAGGTGGCTTAGCGGCTGGGGAGCAAATAAGGTTAGTAAGTTCAGGGAAAAAAAGTAAGGTGTTAG

Reverse complement sequence

CTAACACCTTACTTTTTTTCCCTGAACTTACTAACCTTATTTGCTCCCCAGCCGCTAAGCCACCTTTTAACCAGCCGCTAAGTCACTTTTTAAGAAAAGG[C/T]
ATCAGTAAATAACAGAAATCAACTTATCCCTTTATATGCCACATCATCTTTTTTAAATGTTCTAAAAACACTCATGTTGAAGCTAACCCATCTCTCTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.00% 0.87% 0.00% NA
All Indica  2759 95.20% 3.40% 1.41% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 0.00% 1.51% 0.00% NA
Indica II  465 87.30% 8.80% 3.87% 0.00% NA
Indica III  913 96.80% 2.80% 0.33% 0.00% NA
Indica Intermediate  786 95.50% 3.30% 1.15% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119100956 G -> A LOC_Os11g32330.1 downstream_gene_variant ; 2495.0bp to feature; MODIFIER silent_mutation Average:40.068; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1119100956 G -> A LOC_Os11g32340.1 downstream_gene_variant ; 3278.0bp to feature; MODIFIER silent_mutation Average:40.068; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N
vg1119100956 G -> A LOC_Os11g32330-LOC_Os11g32340 intergenic_region ; MODIFIER silent_mutation Average:40.068; most accessible tissue: Zhenshan97 young leaf, score: 61.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119100956 4.96E-06 4.96E-06 mr1054 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 NA 7.64E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 NA 2.63E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 1.07E-06 1.07E-06 mr1287 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 NA 2.30E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 4.67E-06 1.43E-07 mr1372 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 NA 1.37E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 NA 1.38E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 8.23E-06 8.23E-06 mr1724 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 NA 4.57E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 NA 9.84E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 NA 5.88E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 3.17E-06 5.73E-09 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119100956 2.88E-06 2.88E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251