\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119034181:

Variant ID: vg1119034181 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 19034181
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TTGACCGTTTATCTTATTTAAAAATATAAGATCAATGTGTGTTTTGATTCTTATTCTGTGATGAACAATTGGCATCTGTGATTATTGATTTTGATATTTG[G/A]
AATTTATTCACGAAGTGGTTTTGGAGATGATTGGATTTCACAGGTGATCTACAGGAGGATACTGTTGAATTGTGGTCCGGTCAGACCAGGCTAGTGTGGC

Reverse complement sequence

GCCACACTAGCCTGGTCTGACCGGACCACAATTCAACAGTATCCTCCTGTAGATCACCTGTGAAATCCAATCATCTCCAAAACCACTTCGTGAATAAATT[C/T]
CAAATATCAAAATCAATAATCACAGATGCCAATTGTTCATCACAGAATAAGAATCAAAACACACATTGATCTTATATTTTTAAATAAGATAAACGGTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 11.30% 0.02% 0.00% NA
All Indica  2759 89.00% 11.00% 0.04% 0.00% NA
All Japonica  1512 95.00% 5.00% 0.00% 0.00% NA
Aus  269 50.60% 49.40% 0.00% 0.00% NA
Indica I  595 94.30% 5.70% 0.00% 0.00% NA
Indica II  465 73.80% 26.20% 0.00% 0.00% NA
Indica III  913 95.80% 4.20% 0.00% 0.00% NA
Indica Intermediate  786 86.00% 13.90% 0.13% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 88.90% 11.10% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1119034181 G -> A LOC_Os11g32210.1 upstream_gene_variant ; 4791.0bp to feature; MODIFIER silent_mutation Average:67.902; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg1119034181 G -> A LOC_Os11g32220.1 downstream_gene_variant ; 2030.0bp to feature; MODIFIER silent_mutation Average:67.902; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N
vg1119034181 G -> A LOC_Os11g32210-LOC_Os11g32220 intergenic_region ; MODIFIER silent_mutation Average:67.902; most accessible tissue: Zhenshan97 flower, score: 87.488 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1119034181 3.69E-06 3.69E-06 mr1025 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119034181 NA 4.04E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119034181 NA 1.51E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119034181 1.04E-06 1.04E-06 mr1159 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119034181 NA 1.90E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251