Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1119032991:

Variant ID: vg1119032991 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 19032991
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTATATCTCTAGTATATATAATATTTTCTTTACTGAACAAGAAGCTAAAAACCAAGTACTGGCAAGTTAGGCAACCACCTGAACTAAACCAAAATACT[C/T,A]
CCTCCTTCCCTAAATGTTTGACACCGTTAAATTTTTTAAACATGTTTGACCGTTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATTAAA

Reverse complement sequence

TTTAATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACAACGGTCAAACATGTTTAAAAAATTTAACGGTGTCAAACATTTAGGGAAGGAGG[G/A,T]
AGTATTTTGGTTTAGTTCAGGTGGTTGCCTAACTTGCCAGTACTTGGTTTTTAGCTTCTTGTTCAGTAAAGAAAATATTATATATACTAGAGATATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.50%	46.30%	2.14%	1.04%	A: 0.08%
All Indica	2759	82.70%	15.90%	0.58%	0.80%	NA
All Japonica	1512	2.10%	95.50%	2.18%	0.20%	A: 0.07%
Aus	269	12.30%	61.30%	17.10%	8.55%	A: 0.74%
Indica I	595	91.60%	8.10%	0.34%	0.00%	NA
Indica II	465	71.40%	26.90%	0.43%	1.29%	NA
Indica III	913	86.50%	12.00%	0.11%	1.31%	NA
Indica Intermediate	786	78.20%	19.80%	1.40%	0.51%	NA
Temperate Japonica	767	1.30%	96.00%	2.35%	0.39%	NA
Tropical Japonica	504	3.00%	96.20%	0.79%	0.00%	NA
Japonica Intermediate	241	2.50%	92.50%	4.56%	0.00%	A: 0.41%
VI/Aromatic	96	2.10%	92.70%	3.12%	1.04%	A: 1.04%
Intermediate	90	41.10%	55.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1119032991	C -> T	LOC_Os11g32210.1	upstream_gene_variant ; 3601.0bp to feature; MODIFIER	silent_mutation	Average:33.936; most accessible tissue: Callus, score: 81.971	N	N	N	N
vg1119032991	C -> T	LOC_Os11g32220.1	downstream_gene_variant ; 3220.0bp to feature; MODIFIER	silent_mutation	Average:33.936; most accessible tissue: Callus, score: 81.971	N	N	N	N
vg1119032991	C -> T	LOC_Os11g32210-LOC_Os11g32220	intergenic_region ; MODIFIER	silent_mutation	Average:33.936; most accessible tissue: Callus, score: 81.971	N	N	N	N
vg1119032991	C -> A	LOC_Os11g32210.1	upstream_gene_variant ; 3601.0bp to feature; MODIFIER	silent_mutation	Average:33.936; most accessible tissue: Callus, score: 81.971	N	N	N	N
vg1119032991	C -> A	LOC_Os11g32220.1	downstream_gene_variant ; 3220.0bp to feature; MODIFIER	silent_mutation	Average:33.936; most accessible tissue: Callus, score: 81.971	N	N	N	N
vg1119032991	C -> A	LOC_Os11g32210-LOC_Os11g32220	intergenic_region ; MODIFIER	silent_mutation	Average:33.936; most accessible tissue: Callus, score: 81.971	N	N	N	N
vg1119032991	C -> DEL	N	N	silent_mutation	Average:33.936; most accessible tissue: Callus, score: 81.971	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1119032991	1.81E-06	1.81E-06	mr1025	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119032991	NA	2.72E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119032991	NA	1.16E-18	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119032991	NA	3.06E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119032991	NA	7.47E-10	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119032991	NA	4.55E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1119032991	NA	2.00E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251