\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118881298:

Variant ID: vg1118881298 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18881298
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGGCACCCAAGCTAAGAGTAGCAGAAGAAGAAAGGGAAAACAAAAGTTACTAATCTCCCAACCAAACCTCCAAACTACCCAAACCCGCGCGGAGCCA[T/A]
TGGCGCCCCTCTTGCAACATGCAATCAACTACTCTGTCTACCGGACACAAGATGTTGTAGAAGACACGCACATTACACTCTTTCCAAACACAAGGTGTTG

Reverse complement sequence

CAACACCTTGTGTTTGGAAAGAGTGTAATGTGCGTGTCTTCTACAACATCTTGTGTCCGGTAGACAGAGTAGTTGATTGCATGTTGCAAGAGGGGCGCCA[A/T]
TGGCTCCGCGCGGGTTTGGGTAGTTTGGAGGTTTGGTTGGGAGATTAGTAACTTTTGTTTTCCCTTTCTTCTTCTGCTACTCTTAGCTTGGGTGCCCATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 10.30% 0.02% 0.00% NA
All Indica  2759 84.20% 15.70% 0.04% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 93.10% 6.90% 0.00% 0.00% NA
Indica II  465 71.20% 28.80% 0.00% 0.00% NA
Indica III  913 85.90% 14.00% 0.11% 0.00% NA
Indica Intermediate  786 83.30% 16.70% 0.00% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118881298 T -> A LOC_Os11g32030.1 downstream_gene_variant ; 4267.0bp to feature; MODIFIER silent_mutation Average:63.258; most accessible tissue: Callus, score: 84.207 N N N N
vg1118881298 T -> A LOC_Os11g32040.1 downstream_gene_variant ; 2186.0bp to feature; MODIFIER silent_mutation Average:63.258; most accessible tissue: Callus, score: 84.207 N N N N
vg1118881298 T -> A LOC_Os11g32050.1 downstream_gene_variant ; 4571.0bp to feature; MODIFIER silent_mutation Average:63.258; most accessible tissue: Callus, score: 84.207 N N N N
vg1118881298 T -> A LOC_Os11g32030-LOC_Os11g32040 intergenic_region ; MODIFIER silent_mutation Average:63.258; most accessible tissue: Callus, score: 84.207 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118881298 NA 5.91E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 5.09E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 4.41E-10 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 1.16E-07 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 3.31E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 5.96E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 5.10E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 3.26E-06 3.27E-06 mr1500_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 1.64E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 8.54E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 4.54E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 3.42E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 6.98E-07 mr1837_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 NA 1.90E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118881298 7.03E-06 7.04E-06 mr1956_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251