Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118755597:

Variant ID: vg1118755597 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 18755597
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACGCGCGCACGATATGATTTATCTCGACTGCCACAACCGCATATCCACCTCATGCGCCGCAAGCGGGCGAATGGGATTAGTGGAAGCGAGGGCGCGAGA[T/A]
ACGAGGGGGCGAAATAGTGGGCACGAGAAGCGAGGAGCCGGGCACAGCGTTGGCAAGAGTATAAAGGCACTGAGGAAAGGATCTGCTTCCTTCCTTTCGC

Reverse complement sequence

GCGAAAGGAAGGAAGCAGATCCTTTCCTCAGTGCCTTTATACTCTTGCCAACGCTGTGCCCGGCTCCTCGCTTCTCGTGCCCACTATTTCGCCCCCTCGT[A/T]
TCTCGCGCCCTCGCTTCCACTAATCCCATTCGCCCGCTTGCGGCGCATGAGGTGGATATGCGGTTGTGGCAGTCGAGATAAATCATATCGTGCGCGCGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.40%	2.40%	21.86%	1.42%	NA
All Indica	2759	64.10%	3.40%	30.84%	1.67%	NA
All Japonica	1512	97.10%	0.00%	1.52%	1.39%	NA
Aus	269	44.20%	5.90%	49.81%	0.00%	NA
Indica I	595	73.10%	3.90%	19.83%	3.19%	NA
Indica II	465	58.10%	4.70%	36.56%	0.65%	NA
Indica III	913	59.70%	2.30%	36.36%	1.64%	NA
Indica Intermediate	786	65.90%	3.60%	29.39%	1.15%	NA
Temperate Japonica	767	96.90%	0.00%	0.65%	2.48%	NA
Tropical Japonica	504	96.40%	0.00%	3.17%	0.40%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	89.60%	0.00%	10.42%	0.00%	NA
Intermediate	90	81.10%	2.20%	16.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1118755597	T -> A	LOC_Os11g31910.1	5_prime_UTR_variant ; 203.0bp to feature; MODIFIER	silent_mutation	Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567	N	N	N	N
vg1118755597	T -> A	LOC_Os11g31900.1	upstream_gene_variant ; 2311.0bp to feature; MODIFIER	silent_mutation	Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567	N	N	N	N
vg1118755597	T -> A	LOC_Os11g31900.2	upstream_gene_variant ; 2321.0bp to feature; MODIFIER	silent_mutation	Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567	N	N	N	N
vg1118755597	T -> A	LOC_Os11g31900.3	upstream_gene_variant ; 2982.0bp to feature; MODIFIER	silent_mutation	Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567	N	N	N	N
vg1118755597	T -> A	LOC_Os11g31920.1	downstream_gene_variant ; 4112.0bp to feature; MODIFIER	silent_mutation	Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567	N	N	N	N
vg1118755597	T -> DEL	N	N	silent_mutation	Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1118755597	T	A	-0.02	-0.02	-0.02	-0.02	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1118755597	NA	8.45E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	1.51E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	7.52E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	4.30E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	3.41E-28	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	9.95E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	3.00E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	1.48E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	3.25E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	9.10E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	9.91E-25	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	1.53E-26	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	4.73E-20	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	1.37E-21	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	8.46E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	1.82E-33	mr1944	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	3.31E-07	5.91E-06	mr1082_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597	NA	3.35E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251