\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118755597:

Variant ID: vg1118755597 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18755597
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACGCGCGCACGATATGATTTATCTCGACTGCCACAACCGCATATCCACCTCATGCGCCGCAAGCGGGCGAATGGGATTAGTGGAAGCGAGGGCGCGAGA[T/A]
ACGAGGGGGCGAAATAGTGGGCACGAGAAGCGAGGAGCCGGGCACAGCGTTGGCAAGAGTATAAAGGCACTGAGGAAAGGATCTGCTTCCTTCCTTTCGC

Reverse complement sequence

GCGAAAGGAAGGAAGCAGATCCTTTCCTCAGTGCCTTTATACTCTTGCCAACGCTGTGCCCGGCTCCTCGCTTCTCGTGCCCACTATTTCGCCCCCTCGT[A/T]
TCTCGCGCCCTCGCTTCCACTAATCCCATTCGCCCGCTTGCGGCGCATGAGGTGGATATGCGGTTGTGGCAGTCGAGATAAATCATATCGTGCGCGCGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 2.40% 21.86% 1.42% NA
All Indica  2759 64.10% 3.40% 30.84% 1.67% NA
All Japonica  1512 97.10% 0.00% 1.52% 1.39% NA
Aus  269 44.20% 5.90% 49.81% 0.00% NA
Indica I  595 73.10% 3.90% 19.83% 3.19% NA
Indica II  465 58.10% 4.70% 36.56% 0.65% NA
Indica III  913 59.70% 2.30% 36.36% 1.64% NA
Indica Intermediate  786 65.90% 3.60% 29.39% 1.15% NA
Temperate Japonica  767 96.90% 0.00% 0.65% 2.48% NA
Tropical Japonica  504 96.40% 0.00% 3.17% 0.40% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 89.60% 0.00% 10.42% 0.00% NA
Intermediate  90 81.10% 2.20% 16.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118755597 T -> A LOC_Os11g31910.1 5_prime_UTR_variant ; 203.0bp to feature; MODIFIER silent_mutation Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567 N N N N
vg1118755597 T -> A LOC_Os11g31900.1 upstream_gene_variant ; 2311.0bp to feature; MODIFIER silent_mutation Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567 N N N N
vg1118755597 T -> A LOC_Os11g31900.2 upstream_gene_variant ; 2321.0bp to feature; MODIFIER silent_mutation Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567 N N N N
vg1118755597 T -> A LOC_Os11g31900.3 upstream_gene_variant ; 2982.0bp to feature; MODIFIER silent_mutation Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567 N N N N
vg1118755597 T -> A LOC_Os11g31920.1 downstream_gene_variant ; 4112.0bp to feature; MODIFIER silent_mutation Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567 N N N N
vg1118755597 T -> DEL N N silent_mutation Average:89.524; most accessible tissue: Minghui63 flag leaf, score: 99.567 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118755597 T A -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118755597 NA 8.45E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 1.51E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 7.52E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 4.30E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 3.41E-28 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 9.95E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 3.00E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 1.48E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 3.25E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 9.10E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 9.91E-25 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 1.53E-26 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 4.73E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 1.37E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 8.46E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 1.82E-33 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 3.31E-07 5.91E-06 mr1082_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118755597 NA 3.35E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251