\
| Variant ID: vg1118715674 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18715674 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGAGCAGGTCTCCGGAACCTCTGCCTTCGACGTCCTGCACCGGGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTCGTGCGACTGCTCCCTGTTTGTT[C/T]
GCGACGGCTCGCCTTCCTCTTCGCTCGCGTGTTTCGTGCCTTCGTAGACACCTGCGAAAAGTTTCAACCAATCAGCCGGTCTTTCCGTCATCTCGGTACG
CGTACCGAGATGACGGAAAGACCGGCTGATTGGTTGAAACTTTTCGCAGGTGTCTACGAAGGCACGAAACACGCGAGCGAAGAGGAAGGCGAGCCGTCGC[G/A]
AACAAACAGGGAGCAGTCGCACGAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCCCGGTGCAGGACGTCGAAGGCAGAGGTTCCGGAGACCTGCTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.10% | 0.70% | 17.86% | 9.35% | NA |
| All Indica | 2759 | 58.80% | 0.90% | 26.31% | 13.95% | NA |
| All Japonica | 1512 | 96.00% | 0.00% | 2.18% | 1.79% | NA |
| Aus | 269 | 74.30% | 2.20% | 20.07% | 3.35% | NA |
| Indica I | 595 | 39.00% | 0.00% | 43.53% | 17.48% | NA |
| Indica II | 465 | 51.40% | 0.90% | 29.03% | 18.71% | NA |
| Indica III | 913 | 74.00% | 1.40% | 15.99% | 8.54% | NA |
| Indica Intermediate | 786 | 60.60% | 1.00% | 23.66% | 14.76% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 2.61% | 1.43% | NA |
| Tropical Japonica | 504 | 96.00% | 0.00% | 1.98% | 1.98% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 1.24% | 2.49% | NA |
| VI/Aromatic | 96 | 77.10% | 0.00% | 15.62% | 7.29% | NA |
| Intermediate | 90 | 66.70% | 0.00% | 17.78% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118715674 | C -> T | LOC_Os11g31850.1 | downstream_gene_variant ; 2786.0bp to feature; MODIFIER | silent_mutation | Average:31.577; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1118715674 | C -> T | LOC_Os11g31840.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.577; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1118715674 | C -> DEL | N | N | silent_mutation | Average:31.577; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118715674 | NA | 2.66E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118715674 | NA | 2.68E-06 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118715674 | 3.75E-06 | 3.76E-06 | mr1385 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118715674 | 1.55E-06 | 1.55E-06 | mr1643 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118715674 | 1.35E-07 | NA | mr1248_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118715674 | NA | 8.81E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118715674 | NA | 1.18E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118715674 | NA | 2.77E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |