\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118675422:

Variant ID: vg1118675422 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18675422
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCACTGACAACCATATATTATGTATCATCTTACGCACATACGCTGCGCGATTATTGCTAGTTTTAATTAATATGGTCTAGGTCTGGCCTTATGAAGGGG[A/G]
GATTGTTTTTTTTTTGGTGATTCTTCGTGGTTCTGTGCTGGAACACTAGGAACCCTGGAGGCGCATCCTCCTACATCTATCTGCTGCCGATCCAACTTGG

Reverse complement sequence

CCAAGTTGGATCGGCAGCAGATAGATGTAGGAGGATGCGCCTCCAGGGTTCCTAGTGTTCCAGCACAGAACCACGAAGAATCACCAAAAAAAAAACAATC[T/C]
CCCCTTCATAAGGCCAGACCTAGACCATATTAATTAAAACTAGCAATAATCGCGCAGCGTATGTGCGTAAGATGATACATAATATATGGTTGTCAGTGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 2.40% 2.96% 14.09% NA
All Indica  2759 73.70% 0.00% 3.81% 22.44% NA
All Japonica  1512 89.40% 7.20% 2.31% 1.06% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 79.80% 0.00% 2.18% 17.98% NA
Indica II  465 83.00% 0.00% 4.30% 12.69% NA
Indica III  913 66.80% 0.00% 3.61% 29.57% NA
Indica Intermediate  786 71.60% 0.10% 4.96% 23.28% NA
Temperate Japonica  767 81.10% 14.20% 3.78% 0.91% NA
Tropical Japonica  504 99.20% 0.00% 0.60% 0.20% NA
Japonica Intermediate  241 95.40% 0.00% 1.24% 3.32% NA
VI/Aromatic  96 84.40% 0.00% 0.00% 15.62% NA
Intermediate  90 80.00% 3.30% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118675422 A -> DEL N N silent_mutation Average:78.237; most accessible tissue: Zhenshan97 root, score: 91.026 N N N N
vg1118675422 A -> G LOC_Os11g31810.1 downstream_gene_variant ; 3039.0bp to feature; MODIFIER silent_mutation Average:78.237; most accessible tissue: Zhenshan97 root, score: 91.026 N N N N
vg1118675422 A -> G LOC_Os11g31810-LOC_Os11g31820 intergenic_region ; MODIFIER silent_mutation Average:78.237; most accessible tissue: Zhenshan97 root, score: 91.026 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118675422 A G 0.08 0.01 0.0 0.0 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118675422 8.02E-06 4.70E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118675422 NA 1.04E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118675422 2.37E-06 1.67E-09 mr1163 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118675422 NA 1.80E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118675422 NA 3.16E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251