\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118594055:

Variant ID: vg1118594055 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18594055
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTGTAACCAAAGATTTTGGAAACATGTTTGATTCCCAAACGTTCTTTACCATCTATGTTAAAAGTTTGTAGGATCGAATCACAAGAACTAAGCCAAC[C/T]
AGAGGGGGGGTGAATGGTTGGTATACCCAAAAATCGAAAACTTTTAGCGGAAATAAAAGTTACCCTCGAAATCGACGGATCGCGGTCTGACCGAAGTTAC

Reverse complement sequence

GTAACTTCGGTCAGACCGCGATCCGTCGATTTCGAGGGTAACTTTTATTTCCGCTAAAAGTTTTCGATTTTTGGGTATACCAACCATTCACCCCCCCTCT[G/A]
GTTGGCTTAGTTCTTGTGATTCGATCCTACAAACTTTTAACATAGATGGTAAAGAACGTTTGGGAATCAAACATGTTTCCAAAATCTTTGGTTACACTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.80% 8.30% 6.26% 16.63% NA
All Indica  2759 66.30% 0.30% 7.83% 25.63% NA
All Japonica  1512 68.00% 24.90% 3.97% 3.17% NA
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 73.80% 0.00% 3.87% 22.35% NA
Indica II  465 62.80% 0.00% 5.16% 32.04% NA
Indica III  913 64.70% 0.30% 10.51% 24.42% NA
Indica Intermediate  786 64.50% 0.50% 9.29% 25.70% NA
Temperate Japonica  767 92.40% 2.90% 3.26% 1.43% NA
Tropical Japonica  504 30.40% 60.10% 3.77% 5.75% NA
Japonica Intermediate  241 68.90% 21.20% 6.64% 3.32% NA
VI/Aromatic  96 75.00% 2.10% 17.71% 5.21% NA
Intermediate  90 61.10% 8.90% 2.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118594055 C -> T LOC_Os11g31720.1 downstream_gene_variant ; 2157.0bp to feature; MODIFIER silent_mutation Average:46.86; most accessible tissue: Zhenshan97 flower, score: 65.164 N N N N
vg1118594055 C -> T LOC_Os11g31715-LOC_Os11g31720 intergenic_region ; MODIFIER silent_mutation Average:46.86; most accessible tissue: Zhenshan97 flower, score: 65.164 N N N N
vg1118594055 C -> DEL N N silent_mutation Average:46.86; most accessible tissue: Zhenshan97 flower, score: 65.164 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118594055 3.80E-07 NA Grain_width All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1118594055 NA 4.48E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 4.03E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 1.91E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 1.11E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 6.25E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 9.67E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 5.01E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 8.80E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 8.89E-14 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 1.81E-13 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 2.36E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 4.29E-14 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 6.73E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 5.78E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 9.31E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055 NA 3.03E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251