Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118594055:

Variant ID: vg1118594055 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 18594055
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGTGTAACCAAAGATTTTGGAAACATGTTTGATTCCCAAACGTTCTTTACCATCTATGTTAAAAGTTTGTAGGATCGAATCACAAGAACTAAGCCAAC[C/T]
AGAGGGGGGGTGAATGGTTGGTATACCCAAAAATCGAAAACTTTTAGCGGAAATAAAAGTTACCCTCGAAATCGACGGATCGCGGTCTGACCGAAGTTAC

Reverse complement sequence

GTAACTTCGGTCAGACCGCGATCCGTCGATTTCGAGGGTAACTTTTATTTCCGCTAAAAGTTTTCGATTTTTGGGTATACCAACCATTCACCCCCCCTCT[G/A]
GTTGGCTTAGTTCTTGTGATTCGATCCTACAAACTTTTAACATAGATGGTAAAGAACGTTTGGGAATCAAACATGTTTCCAAAATCTTTGGTTACACTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	8.30%	6.26%	16.63%	NA
All Indica	2759	66.30%	0.30%	7.83%	25.63%	NA
All Japonica	1512	68.00%	24.90%	3.97%	3.17%	NA
Aus	269	99.30%	0.00%	0.37%	0.37%	NA
Indica I	595	73.80%	0.00%	3.87%	22.35%	NA
Indica II	465	62.80%	0.00%	5.16%	32.04%	NA
Indica III	913	64.70%	0.30%	10.51%	24.42%	NA
Indica Intermediate	786	64.50%	0.50%	9.29%	25.70%	NA
Temperate Japonica	767	92.40%	2.90%	3.26%	1.43%	NA
Tropical Japonica	504	30.40%	60.10%	3.77%	5.75%	NA
Japonica Intermediate	241	68.90%	21.20%	6.64%	3.32%	NA
VI/Aromatic	96	75.00%	2.10%	17.71%	5.21%	NA
Intermediate	90	61.10%	8.90%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1118594055	C -> T	LOC_Os11g31720.1	downstream_gene_variant ; 2157.0bp to feature; MODIFIER	silent_mutation	Average:46.86; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N
vg1118594055	C -> T	LOC_Os11g31715-LOC_Os11g31720	intergenic_region ; MODIFIER	silent_mutation	Average:46.86; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N
vg1118594055	C -> DEL	N	N	silent_mutation	Average:46.86; most accessible tissue: Zhenshan97 flower, score: 65.164	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1118594055	3.80E-07	NA	Grain_width	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1118594055	NA	4.48E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	4.03E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	1.91E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	1.11E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	6.25E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	9.67E-08	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	5.01E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	8.80E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	8.89E-14	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	1.81E-13	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	2.36E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	4.29E-14	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	6.73E-06	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	5.78E-14	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	9.31E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118594055	NA	3.03E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251