\
| Variant ID: vg1118572833 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18572833 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 286. )
AAACGATGTGTTTCGTGCGAAAACTTTCTATATGAAAGTTGCTCTAAAATATTATACTAATCCATTTTCAAGTTTGTAATAATTAAAATCAATTAATCAC[A/T]
TGTTATTACCACCTCGTTTTGCGTGAAAAACTTAATATTTATCTTCATCTTCATCTTCAGGAGATTCAAACACTACCTTAGTACAAATTCGGTTTTGCGG
CCGCAAAACCGAATTTGTACTAAGGTAGTGTTTGAATCTCCTGAAGATGAAGATGAAGATAAATATTAAGTTTTTCACGCAAAACGAGGTGGTAATAACA[T/A]
GTGATTAATTGATTTTAATTATTACAAACTTGAAAATGGATTAGTATAATATTTTAGAGCAACTTTCATATAGAAAGTTTTCGCACGAAACACATCGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.40% | 3.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 94.70% | 5.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.50% | 4.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118572833 | A -> T | LOC_Os11g31705.1 | upstream_gene_variant ; 2880.0bp to feature; MODIFIER | silent_mutation | Average:29.059; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1118572833 | A -> T | LOC_Os11g31710.1 | downstream_gene_variant ; 4135.0bp to feature; MODIFIER | silent_mutation | Average:29.059; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1118572833 | A -> T | LOC_Os11g31705-LOC_Os11g31710 | intergenic_region ; MODIFIER | silent_mutation | Average:29.059; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118572833 | NA | 2.21E-08 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118572833 | NA | 3.73E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118572833 | NA | 6.63E-10 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118572833 | NA | 4.12E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118572833 | NA | 7.61E-11 | mr1828_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118572833 | NA | 3.47E-10 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118572833 | NA | 3.95E-09 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118572833 | NA | 1.58E-06 | mr1938_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |