Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1118572833:

Variant ID: vg1118572833 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 18572833
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

AAACGATGTGTTTCGTGCGAAAACTTTCTATATGAAAGTTGCTCTAAAATATTATACTAATCCATTTTCAAGTTTGTAATAATTAAAATCAATTAATCAC[A/T]
TGTTATTACCACCTCGTTTTGCGTGAAAAACTTAATATTTATCTTCATCTTCATCTTCAGGAGATTCAAACACTACCTTAGTACAAATTCGGTTTTGCGG

Reverse complement sequence

CCGCAAAACCGAATTTGTACTAAGGTAGTGTTTGAATCTCCTGAAGATGAAGATGAAGATAAATATTAAGTTTTTCACGCAAAACGAGGTGGTAATAACA[T/A]
GTGATTAATTGATTTTAATTATTACAAACTTGAAAATGGATTAGTATAATATTTTAGAGCAACTTTCATATAGAAAGTTTTCGCACGAAACACATCGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.40%	3.60%	0.02%	0.00%	NA
All Indica	2759	94.70%	5.20%	0.04%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.50%	4.40%	0.17%	0.00%	NA
Indica II	465	81.10%	18.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.20%	3.80%	0.00%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1118572833	A -> T	LOC_Os11g31705.1	upstream_gene_variant ; 2880.0bp to feature; MODIFIER	silent_mutation	Average:29.059; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1118572833	A -> T	LOC_Os11g31710.1	downstream_gene_variant ; 4135.0bp to feature; MODIFIER	silent_mutation	Average:29.059; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg1118572833	A -> T	LOC_Os11g31705-LOC_Os11g31710	intergenic_region ; MODIFIER	silent_mutation	Average:29.059; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1118572833	NA	2.21E-08	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833	NA	3.73E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833	NA	6.63E-10	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833	NA	4.12E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833	NA	7.61E-11	mr1828_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833	NA	3.47E-10	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833	NA	3.95E-09	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833	NA	1.58E-06	mr1938_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251