\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118572833:

Variant ID: vg1118572833 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18572833
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AAACGATGTGTTTCGTGCGAAAACTTTCTATATGAAAGTTGCTCTAAAATATTATACTAATCCATTTTCAAGTTTGTAATAATTAAAATCAATTAATCAC[A/T]
TGTTATTACCACCTCGTTTTGCGTGAAAAACTTAATATTTATCTTCATCTTCATCTTCAGGAGATTCAAACACTACCTTAGTACAAATTCGGTTTTGCGG

Reverse complement sequence

CCGCAAAACCGAATTTGTACTAAGGTAGTGTTTGAATCTCCTGAAGATGAAGATGAAGATAAATATTAAGTTTTTCACGCAAAACGAGGTGGTAATAACA[T/A]
GTGATTAATTGATTTTAATTATTACAAACTTGAAAATGGATTAGTATAATATTTTAGAGCAACTTTCATATAGAAAGTTTTCGCACGAAACACATCGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.40% 3.60% 0.02% 0.00% NA
All Indica  2759 94.70% 5.20% 0.04% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.50% 4.40% 0.17% 0.00% NA
Indica II  465 81.10% 18.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.80% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118572833 A -> T LOC_Os11g31705.1 upstream_gene_variant ; 2880.0bp to feature; MODIFIER silent_mutation Average:29.059; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1118572833 A -> T LOC_Os11g31710.1 downstream_gene_variant ; 4135.0bp to feature; MODIFIER silent_mutation Average:29.059; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1118572833 A -> T LOC_Os11g31705-LOC_Os11g31710 intergenic_region ; MODIFIER silent_mutation Average:29.059; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118572833 NA 2.21E-08 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833 NA 3.73E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833 NA 6.63E-10 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833 NA 4.12E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833 NA 7.61E-11 mr1828_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833 NA 3.47E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833 NA 3.95E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118572833 NA 1.58E-06 mr1938_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251