\
| Variant ID: vg1118531424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18531424 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACACTCACAACGTTTCACTATATATAGATCTAATGTTGCAGTGAACTAAAATATTCCATTGCAACAAATCACCCACATATTTTAGAAATCCTCTGTTAAG[G/A]
AAATTTGTTTTATTTTTTGTTCCACAAAAAATATTTCACCTAATGTACTTACAATGTTTTACAATGTTTCACTATGTATGGATCAAATGTTGCAGTGAAC
GTTCACTGCAACATTTGATCCATACATAGTGAAACATTGTAAAACATTGTAAGTACATTAGGTGAAATATTTTTTGTGGAACAAAAAATAAAACAAATTT[C/T]
CTTAACAGAGGATTTCTAAAATATGTGGGTGATTTGTTGCAATGGAATATTTTAGTTCACTGCAACATTAGATCTATATATAGTGAAACGTTGTGAGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 4.00% | 0.53% | 1.69% | NA |
| All Indica | 2759 | 96.80% | 0.80% | 0.40% | 1.96% | NA |
| All Japonica | 1512 | 98.30% | 0.30% | 0.26% | 1.19% | NA |
| Aus | 269 | 42.40% | 55.80% | 1.49% | 0.37% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.40% | 0.43% | 0.43% | NA |
| Indica III | 913 | 93.90% | 1.30% | 0.66% | 4.16% | NA |
| Indica Intermediate | 786 | 97.10% | 0.90% | 0.25% | 1.78% | NA |
| Temperate Japonica | 767 | 97.70% | 0.00% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 1.70% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 10.40% | 5.21% | 7.29% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118531424 | G -> A | LOC_Os11g31680.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.867; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg1118531424 | G -> DEL | N | N | silent_mutation | Average:39.867; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118531424 | 3.18E-06 | 2.70E-17 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | 4.66E-08 | 1.16E-20 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | 1.70E-06 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | 7.15E-07 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | NA | 1.72E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | 1.26E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | 1.70E-07 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | 2.68E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | 9.34E-08 | 8.63E-19 | mr1240_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | 4.91E-07 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118531424 | 7.57E-06 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |