\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118461807:

Variant ID: vg1118461807 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18461807
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCACAGAGACTCTTCTCTATCCTTTTTTTCTCGTTGTTTTTGAGTCTGGTTGTCTTCGTTAGGTAGCCTAGTGTGCTTTTTTTCTCAAACGCGCAAAAG[G/A]
ATTGCACGTCAATATATTAGAGGAATAGAATATTTGTTACGCGACGCAATCAGTCAGACCGACCTATGCCAAGAAAAGAGAAAAAAAAAACCAAATTAAA

Reverse complement sequence

TTTAATTTGGTTTTTTTTTTCTCTTTTCTTGGCATAGGTCGGTCTGACTGATTGCGTCGCGTAACAAATATTCTATTCCTCTAATATATTGACGTGCAAT[C/T]
CTTTTGCGCGTTTGAGAAAAAAAGCACACTAGGCTACCTAACGAAGACAACCAGACTCAAAAACAACGAGAAAAAAAGGATAGAGAAGAGTCTCTGTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.20% 0.02% 0.36% NA
All Indica  2759 96.50% 3.50% 0.00% 0.00% NA
All Japonica  1512 92.00% 6.90% 0.07% 1.06% NA
Aus  269 68.80% 30.90% 0.00% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 93.20% 6.80% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.70% 0.00% 0.00% NA
Temperate Japonica  767 97.80% 0.00% 0.13% 2.09% NA
Tropical Japonica  504 81.20% 18.80% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118461807 G -> A LOC_Os11g31590.1 downstream_gene_variant ; 2413.0bp to feature; MODIFIER silent_mutation Average:75.739; most accessible tissue: Minghui63 root, score: 91.729 N N N N
vg1118461807 G -> A LOC_Os11g31570-LOC_Os11g31590 intergenic_region ; MODIFIER silent_mutation Average:75.739; most accessible tissue: Minghui63 root, score: 91.729 N N N N
vg1118461807 G -> DEL N N silent_mutation Average:75.739; most accessible tissue: Minghui63 root, score: 91.729 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118461807 G A -0.06 -0.02 0.0 -0.01 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118461807 NA 1.24E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118461807 NA 2.74E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118461807 NA 1.38E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118461807 2.44E-06 2.36E-13 mr1808_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118461807 NA 1.87E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251