\
| Variant ID: vg1118447476 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18447476 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGTTCACGTTAAAATTAAAAATTTGGTTGAAATTGGAACGATGTGACGGAAAAATTAAAAGTTTGTATGTAGAAAAGTTTTGATGTGATGAAAAAGTTG[G/A]
AAGTTTGAAGAAAAAGTTTAGAACTAAACTCGGCCTAACTGCAAACATGCTTGCACTATCCTTGATGGTGTAAAGTTTCAAACACAATCCAAGCCATGGC
GCCATGGCTTGGATTGTGTTTGAAACTTTACACCATCAAGGATAGTGCAAGCATGTTTGCAGTTAGGCCGAGTTTAGTTCTAAACTTTTTCTTCAAACTT[C/T]
CAACTTTTTCATCACATCAAAACTTTTCTACATACAAACTTTTAATTTTTCCGTCACATCGTTCCAATTTCAACCAAATTTTTAATTTTAACGTGAACTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 7.70% | 1.31% | 0.47% | NA |
| All Indica | 2759 | 91.20% | 7.40% | 0.62% | 0.80% | NA |
| All Japonica | 1512 | 92.10% | 6.60% | 1.32% | 0.00% | NA |
| Aus | 269 | 71.40% | 19.70% | 8.92% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.90% | 13.90% | 1.10% | 2.08% | NA |
| Indica Intermediate | 786 | 90.60% | 8.10% | 0.89% | 0.38% | NA |
| Temperate Japonica | 767 | 97.70% | 0.00% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 81.30% | 18.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118447476 | G -> A | LOC_Os11g31560.1 | upstream_gene_variant ; 1826.0bp to feature; MODIFIER | silent_mutation | Average:50.393; most accessible tissue: Callus, score: 96.839 | N | N | N | N |
| vg1118447476 | G -> A | LOC_Os11g31570.1 | downstream_gene_variant ; 817.0bp to feature; MODIFIER | silent_mutation | Average:50.393; most accessible tissue: Callus, score: 96.839 | N | N | N | N |
| vg1118447476 | G -> A | LOC_Os11g31570.2 | downstream_gene_variant ; 817.0bp to feature; MODIFIER | silent_mutation | Average:50.393; most accessible tissue: Callus, score: 96.839 | N | N | N | N |
| vg1118447476 | G -> A | LOC_Os11g31560-LOC_Os11g31570 | intergenic_region ; MODIFIER | silent_mutation | Average:50.393; most accessible tissue: Callus, score: 96.839 | N | N | N | N |
| vg1118447476 | G -> DEL | N | N | silent_mutation | Average:50.393; most accessible tissue: Callus, score: 96.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118447476 | NA | 1.24E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118447476 | NA | 3.70E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118447476 | NA | 1.87E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118447476 | 3.64E-06 | 6.50E-06 | mr1928_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |