\
| Variant ID: vg1118414920 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18414920 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACACATGATGATCTCACAATAGTGAACCAGGTGCATTTTAGATTGTTAGACTTCCTGGTGAAAACCTGAAAGCCTCAGGCTGTCAGTGCTAGTCTCATTT[C/G]
AACAAAATGCAAATTAGTGGCAAATATGCAAAAAAGAAGCTTCAGTTCCTTCACTGACAAATACTCAAAAGTCCTTAGTACTCTTTTCCGGTGAAGGGAA
TTCCCTTCACCGGAAAAGAGTACTAAGGACTTTTGAGTATTTGTCAGTGAAGGAACTGAAGCTTCTTTTTTGCATATTTGCCACTAATTTGCATTTTGTT[G/C]
AAATGAGACTAGCACTGACAGCCTGAGGCTTTCAGGTTTTCACCAGGAAGTCTAACAATCTAAAATGCACCTGGTTCACTATTGTGAGATCATCATGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 38.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 89.20% | 10.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.50% | 22.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 12.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 5.50% | 94.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 40.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118414920 | C -> G | LOC_Os11g31510.1 | upstream_gene_variant ; 2125.0bp to feature; MODIFIER | silent_mutation | Average:34.559; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| vg1118414920 | C -> G | LOC_Os11g31520.1 | upstream_gene_variant ; 4103.0bp to feature; MODIFIER | silent_mutation | Average:34.559; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| vg1118414920 | C -> G | LOC_Os11g31500.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.559; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118414920 | NA | 9.45E-06 | mr1002 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118414920 | NA | 5.86E-11 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118414920 | NA | 6.38E-12 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118414920 | NA | 8.61E-14 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118414920 | NA | 3.68E-08 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118414920 | NA | 3.02E-09 | mr1532 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118414920 | NA | 3.11E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118414920 | NA | 4.04E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118414920 | NA | 1.27E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |