\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118403739:

Variant ID: vg1118403739 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18403739
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGGGCGAGGCGTGCGTCAGATCGCCTGTCGCCACCTAACCCGCGATCTGACCGGTCTGTGACTGGTCACGGACCGGATAAACGAGTGCACTGCGCTGC[G/C]
TTACATACGGCGTGACTCGCTCAGCCAAACCGCAATAAATGTGGTTAGGTGAGCCCCGCTGTGCTCTCCCAACCCATACACGCGGAGCAAAAACCCACGA

Reverse complement sequence

TCGTGGGTTTTTGCTCCGCGTGTATGGGTTGGGAGAGCACAGCGGGGCTCACCTAACCACATTTATTGCGGTTTGGCTGAGCGAGTCACGCCGTATGTAA[C/G]
GCAGCGCAGTGCACTCGTTTATCCGGTCCGTGACCAGTCACAGACCGGTCAGATCGCGGGTTAGGTGGCGACAGGCGATCTGACGCACGCCTCGCCCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 2.60% 16.91% 13.63% NA
All Indica  2759 78.80% 0.00% 9.39% 11.78% NA
All Japonica  1512 43.50% 8.10% 28.57% 19.84% NA
Aus  269 72.50% 0.00% 27.14% 0.37% NA
Indica I  595 77.30% 0.00% 18.32% 4.37% NA
Indica II  465 91.20% 0.00% 2.15% 6.67% NA
Indica III  913 72.80% 0.10% 7.89% 19.17% NA
Indica Intermediate  786 79.50% 0.00% 8.65% 11.83% NA
Temperate Japonica  767 64.50% 12.10% 20.21% 3.13% NA
Tropical Japonica  504 13.30% 1.00% 45.04% 40.67% NA
Japonica Intermediate  241 39.80% 10.00% 20.75% 29.46% NA
VI/Aromatic  96 75.00% 0.00% 9.38% 15.62% NA
Intermediate  90 67.80% 0.00% 28.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118403739 G -> DEL N N silent_mutation Average:84.293; most accessible tissue: Minghui63 flag leaf, score: 96.534 N N N N
vg1118403739 G -> C LOC_Os11g31480.1 upstream_gene_variant ; 4235.0bp to feature; MODIFIER silent_mutation Average:84.293; most accessible tissue: Minghui63 flag leaf, score: 96.534 N N N N
vg1118403739 G -> C LOC_Os11g31490.1 upstream_gene_variant ; 911.0bp to feature; MODIFIER silent_mutation Average:84.293; most accessible tissue: Minghui63 flag leaf, score: 96.534 N N N N
vg1118403739 G -> C LOC_Os11g31490-LOC_Os11g31500 intergenic_region ; MODIFIER silent_mutation Average:84.293; most accessible tissue: Minghui63 flag leaf, score: 96.534 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118403739 G C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118403739 1.48E-06 6.28E-07 mr1517_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251