\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118378850:

Variant ID: vg1118378850 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18378850
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, C: 0.02, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGCCGGCGTCGGATTGGAGGCGGCGCCGACTCAAGGGGGAGGAGGCGGCGCGCGCGCGGTGAGATCGGCCAGACTTGCACCGTAGGATTGGATCCAAA[C/A]
CTGTCCAAATTGCGCATTTGGTGTCTTTTTTTTTTCTTTTTGTTTGGGCTAACCTTTATTATTCTCTTTTTTTATTATTATTATTTTGTATTTTTCAGGT

Reverse complement sequence

ACCTGAAAAATACAAAATAATAATAATAAAAAAAGAGAATAATAAAGGTTAGCCCAAACAAAAAGAAAAAAAAAAGACACCAAATGCGCAATTTGGACAG[G/T]
TTTGGATCCAATCCTACGGTGCAAGTCTGGCCGATCTCACCGCGCGCGCGCCGCCTCCTCCCCCTTGAGTCGGCGCCGCCTCCAATCCGACGCCGGCTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.00% 23.30% 0.28% 30.41% NA
All Indica  2759 42.70% 9.20% 0.43% 47.66% NA
All Japonica  1512 44.70% 53.40% 0.07% 1.79% NA
Aus  269 97.00% 0.40% 0.00% 2.60% NA
Indica I  595 59.70% 20.00% 0.50% 19.83% NA
Indica II  465 39.60% 8.40% 0.43% 51.61% NA
Indica III  913 34.60% 2.10% 0.11% 63.20% NA
Indica Intermediate  786 41.20% 9.70% 0.76% 48.35% NA
Temperate Japonica  767 8.90% 90.10% 0.00% 1.04% NA
Tropical Japonica  504 94.80% 3.40% 0.20% 1.59% NA
Japonica Intermediate  241 53.90% 41.50% 0.00% 4.56% NA
VI/Aromatic  96 9.40% 28.10% 0.00% 62.50% NA
Intermediate  90 53.30% 15.60% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118378850 C -> A LOC_Os11g31450.1 5_prime_UTR_variant ; 2143.0bp to feature; MODIFIER silent_mutation Average:84.635; most accessible tissue: Zhenshan97 flower, score: 93.979 N N N N
vg1118378850 C -> A LOC_Os11g31470.1 upstream_gene_variant ; 3203.0bp to feature; MODIFIER silent_mutation Average:84.635; most accessible tissue: Zhenshan97 flower, score: 93.979 N N N N
vg1118378850 C -> A LOC_Os11g31470.2 upstream_gene_variant ; 3169.0bp to feature; MODIFIER silent_mutation Average:84.635; most accessible tissue: Zhenshan97 flower, score: 93.979 N N N N
vg1118378850 C -> A LOC_Os11g31470.4 upstream_gene_variant ; 3203.0bp to feature; MODIFIER silent_mutation Average:84.635; most accessible tissue: Zhenshan97 flower, score: 93.979 N N N N
vg1118378850 C -> A LOC_Os11g31470.3 upstream_gene_variant ; 3203.0bp to feature; MODIFIER silent_mutation Average:84.635; most accessible tissue: Zhenshan97 flower, score: 93.979 N N N N
vg1118378850 C -> A LOC_Os11g31460.1 downstream_gene_variant ; 1325.0bp to feature; MODIFIER silent_mutation Average:84.635; most accessible tissue: Zhenshan97 flower, score: 93.979 N N N N
vg1118378850 C -> DEL N N silent_mutation Average:84.635; most accessible tissue: Zhenshan97 flower, score: 93.979 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118378850 C A -0.14 -0.14 -0.1 -0.08 -0.09 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118378850 NA 2.17E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.06E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.45E-18 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.31E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.85E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 3.28E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.09E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 8.09E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.05E-14 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.04E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.69E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.70E-11 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.74E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.71E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 3.03E-16 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.32E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.41E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.19E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.28E-06 mr1499_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 6.63E-07 mr1499_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.34E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.20E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.15E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 4.60E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.50E-06 mr1616_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.56E-06 mr1647_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.18E-07 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.87E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.59E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 4.12E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.18E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 2.87E-12 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 3.46E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118378850 NA 1.63E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251