\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118368019:

Variant ID: vg1118368019 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18368019
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCACAATTTTTTAGTATATTGTTTGGTTGGTTGCCACAATTGTATGATGCCTCACTTTGCTAGTCATTGAACCTATGCATCATAGACTCAAATTCTTG[C/T]
CAAACTTAGCACACTTGTGGCTAACAAATTGCTAGCCTCACTTTGTGAGGCATGACACATTTTGTGGCAAAGTGAGGTGTGGCATGACACATTTTGTGGC

Reverse complement sequence

GCCACAAAATGTGTCATGCCACACCTCACTTTGCCACAAAATGTGTCATGCCTCACAAAGTGAGGCTAGCAATTTGTTAGCCACAAGTGTGCTAAGTTTG[G/A]
CAAGAATTTGAGTCTATGATGCATAGGTTCAATGACTAGCAAAGTGAGGCATCATACAATTGTGGCAACCAACCAAACAATATACTAAAAAATTGTGACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.70% 26.90% 0.93% 30.55% NA
All Indica  2759 17.60% 34.30% 1.27% 46.83% NA
All Japonica  1512 88.80% 8.10% 0.26% 2.84% NA
Aus  269 23.80% 66.20% 0.00% 10.04% NA
Indica I  595 26.40% 54.10% 0.17% 19.33% NA
Indica II  465 29.00% 18.30% 2.58% 50.11% NA
Indica III  913 3.70% 32.40% 1.10% 62.76% NA
Indica Intermediate  786 20.40% 30.90% 1.53% 47.20% NA
Temperate Japonica  767 95.40% 1.20% 0.13% 3.26% NA
Tropical Japonica  504 83.50% 14.50% 0.60% 1.39% NA
Japonica Intermediate  241 78.40% 17.00% 0.00% 4.56% NA
VI/Aromatic  96 33.30% 6.20% 2.08% 58.33% NA
Intermediate  90 50.00% 17.80% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118368019 C -> T LOC_Os11g31440.1 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434 N N N N
vg1118368019 C -> T LOC_Os11g31430.1 downstream_gene_variant ; 3519.0bp to feature; MODIFIER silent_mutation Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434 N N N N
vg1118368019 C -> T LOC_Os11g31450.1 downstream_gene_variant ; 4742.0bp to feature; MODIFIER silent_mutation Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434 N N N N
vg1118368019 C -> T LOC_Os11g31430-LOC_Os11g31440 intergenic_region ; MODIFIER silent_mutation Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434 N N N N
vg1118368019 C -> DEL N N silent_mutation Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118368019 NA 1.65E-06 mr1041_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.51E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.57E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 7.74E-06 mr1294_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 3.14E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 7.03E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 9.88E-07 9.87E-07 mr1412_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 5.62E-06 5.62E-06 mr1412_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 2.44E-06 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 9.06E-06 mr1494_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 6.63E-06 mr1499_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 8.36E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 5.32E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.28E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 3.30E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 5.35E-07 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.56E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 5.25E-06 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.91E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 8.55E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 5.18E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.63E-07 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 3.10E-07 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.34E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 4.91E-06 mr1766_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 9.30E-06 2.71E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 9.12E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 3.74E-06 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.59E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 3.19E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 5.05E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.95E-08 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 4.61E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 8.08E-08 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.27E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 1.01E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 9.79E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019 NA 2.10E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251