Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118368019:

Variant ID: vg1118368019 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 18368019
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCACAATTTTTTAGTATATTGTTTGGTTGGTTGCCACAATTGTATGATGCCTCACTTTGCTAGTCATTGAACCTATGCATCATAGACTCAAATTCTTG[C/T]
CAAACTTAGCACACTTGTGGCTAACAAATTGCTAGCCTCACTTTGTGAGGCATGACACATTTTGTGGCAAAGTGAGGTGTGGCATGACACATTTTGTGGC

Reverse complement sequence

GCCACAAAATGTGTCATGCCACACCTCACTTTGCCACAAAATGTGTCATGCCTCACAAAGTGAGGCTAGCAATTTGTTAGCCACAAGTGTGCTAAGTTTG[G/A]
CAAGAATTTGAGTCTATGATGCATAGGTTCAATGACTAGCAAAGTGAGGCATCATACAATTGTGGCAACCAACCAAACAATATACTAAAAAATTGTGACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.70%	26.90%	0.93%	30.55%	NA
All Indica	2759	17.60%	34.30%	1.27%	46.83%	NA
All Japonica	1512	88.80%	8.10%	0.26%	2.84%	NA
Aus	269	23.80%	66.20%	0.00%	10.04%	NA
Indica I	595	26.40%	54.10%	0.17%	19.33%	NA
Indica II	465	29.00%	18.30%	2.58%	50.11%	NA
Indica III	913	3.70%	32.40%	1.10%	62.76%	NA
Indica Intermediate	786	20.40%	30.90%	1.53%	47.20%	NA
Temperate Japonica	767	95.40%	1.20%	0.13%	3.26%	NA
Tropical Japonica	504	83.50%	14.50%	0.60%	1.39%	NA
Japonica Intermediate	241	78.40%	17.00%	0.00%	4.56%	NA
VI/Aromatic	96	33.30%	6.20%	2.08%	58.33%	NA
Intermediate	90	50.00%	17.80%	3.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1118368019	C -> T	LOC_Os11g31440.1	upstream_gene_variant ; 2393.0bp to feature; MODIFIER	silent_mutation	Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg1118368019	C -> T	LOC_Os11g31430.1	downstream_gene_variant ; 3519.0bp to feature; MODIFIER	silent_mutation	Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg1118368019	C -> T	LOC_Os11g31450.1	downstream_gene_variant ; 4742.0bp to feature; MODIFIER	silent_mutation	Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg1118368019	C -> T	LOC_Os11g31430-LOC_Os11g31440	intergenic_region ; MODIFIER	silent_mutation	Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg1118368019	C -> DEL	N	N	silent_mutation	Average:58.324; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1118368019	NA	1.65E-06	mr1041_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.51E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.57E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	7.74E-06	mr1294_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	3.14E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	7.03E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	9.88E-07	9.87E-07	mr1412_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	5.62E-06	5.62E-06	mr1412_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	2.44E-06	mr1494_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	9.06E-06	mr1494_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	6.63E-06	mr1499_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	8.36E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	5.32E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.28E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	3.30E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	5.35E-07	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.56E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	5.25E-06	mr1700_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.91E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	8.55E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	5.18E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.63E-07	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	3.10E-07	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.34E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	4.91E-06	mr1766_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	9.30E-06	2.71E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	9.12E-09	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	3.74E-06	mr1811_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.59E-06	mr1814_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	3.19E-06	mr1823_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	5.05E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.95E-08	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	4.61E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	8.08E-08	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.27E-06	mr1856_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	1.01E-06	mr1876_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	9.79E-06	mr1876_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118368019	NA	2.10E-06	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251