Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118364611:

Variant ID: vg1118364611 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18364611
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


CCTATTTGATGAAATATTGTGCGTCCAGTTCTATGGCATGTCCTCCTTCCAAACTGCACTCATTTATGTCACTCATAAATTTATTCCTGTTTCTTAATAG[T/C]
GACGTATTCCCTCCTTTCCTAAATATTTGACGCCGTTGATTTTTTAAAACATGTTTGACCGTTCGTCTTATTCAAATTTTTTTTGAAATGTGTAAAACTA

Reverse complement sequence

TAGTTTTACACATTTCAAAAAAAATTTGAATAAGACGAACGGTCAAACATGTTTTAAAAAATCAACGGCGTCAAATATTTAGGAAAGGAGGGAATACGTC[A/G]
CTATTAAGAAACAGGAATAAATTTATGAGTGACATAAATGAGTGCAGTTTGGAAGGAGGACATGCCATAGAACTGGACGCACAATATTTCATCAAATAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 27.00% 0.87% 29.73% NA
All Indica  2759 16.70% 35.30% 1.34% 46.72% NA
All Japonica  1512 95.20% 2.90% 0.07% 1.79% NA
Aus  269 10.40% 87.70% 0.00% 1.86% NA
Indica I  595 25.70% 54.10% 1.01% 19.16% NA
Indica II  465 28.40% 19.60% 1.08% 50.97% NA
Indica III  913 3.00% 33.70% 0.99% 62.32% NA
Indica Intermediate  786 18.80% 32.10% 2.16% 46.95% NA
Temperate Japonica  767 95.80% 3.10% 0.00% 1.04% NA
Tropical Japonica  504 95.20% 3.00% 0.20% 1.59% NA
Japonica Intermediate  241 93.40% 2.10% 0.00% 4.56% NA
VI/Aromatic  96 30.20% 6.20% 3.12% 60.42% NA
Intermediate  90 50.00% 21.10% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118364611 T -> DEL N N silent_mutation Average:47.78; most accessible tissue: Zhenshan97 young leaf, score: 73.54 N N N N
vg1118364611 T -> C LOC_Os11g31430.1 downstream_gene_variant ; 111.0bp to feature; MODIFIER silent_mutation Average:47.78; most accessible tissue: Zhenshan97 young leaf, score: 73.54 N N N N
vg1118364611 T -> C LOC_Os11g31430-LOC_Os11g31440 intergenic_region ; MODIFIER silent_mutation Average:47.78; most accessible tissue: Zhenshan97 young leaf, score: 73.54 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118364611 T C 0.02 0.01 0.01 0.01 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118364611 NA 1.88E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 3.98E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 8.30E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 9.52E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 1.75E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 6.06E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 4.93E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 1.40E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 4.42E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 2.27E-06 9.57E-12 mr1794_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 7.84E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 1.97E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 7.04E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 9.77E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 1.07E-07 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118364611 NA 1.07E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251