Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118352952:

Variant ID: vg1118352952 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18352952
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGATTCCTATCATCCGATGCAAACGACCATTGGAGCAGGTTATGAGTCCTTTAGCTGCAGCCATACACCACTAAGCTCCTTTCCTGAACCACCGAGTT[T/A]
ACTGAGGGAGCAACATCATTGAAAACAGTCACATCTGTGCTTCCACAATTCCCATGCAACAAGCGTGATTGGAGAATTCTTGCCCTTCTTGAGATCCCTA

Reverse complement sequence

TAGGGATCTCAAGAAGGGCAAGAATTCTCCAATCACGCTTGTTGCATGGGAATTGTGGAAGCACAGATGTGACTGTTTTCAATGATGTTGCTCCCTCAGT[A/T]
AACTCGGTGGTTCAGGAAAGGAGCTTAGTGGTGTATGGCTGCAGCTAAAGGACTCATAACCTGCTCCAATGGTCGTTTGCATCGGATGATAGGAATCCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 23.30% 0.15% 30.19% NA
All Indica  2759 43.30% 9.00% 0.25% 47.48% NA
All Japonica  1512 44.80% 53.40% 0.00% 1.72% NA
Aus  269 97.40% 0.70% 0.00% 1.86% NA
Indica I  595 59.70% 20.30% 0.17% 19.83% NA
Indica II  465 40.40% 8.20% 0.65% 50.75% NA
Indica III  913 34.70% 2.10% 0.11% 63.09% NA
Indica Intermediate  786 42.50% 8.90% 0.25% 48.35% NA
Temperate Japonica  767 8.90% 90.20% 0.00% 0.91% NA
Tropical Japonica  504 95.20% 3.20% 0.00% 1.59% NA
Japonica Intermediate  241 53.90% 41.50% 0.00% 4.56% NA
VI/Aromatic  96 9.40% 28.10% 0.00% 62.50% NA
Intermediate  90 54.40% 16.70% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118352952 T -> A LOC_Os11g31430.1 intron_variant ; MODIFIER silent_mutation Average:51.553; most accessible tissue: Zhenshan97 young leaf, score: 82.982 N N N N
vg1118352952 T -> DEL N N silent_mutation Average:51.553; most accessible tissue: Zhenshan97 young leaf, score: 82.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118352952 NA 1.47E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1118352952 NA 4.74E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.87E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 5.68E-19 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.10E-08 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.90E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 9.65E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 3.03E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 2.05E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 5.89E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.63E-14 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.59E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 2.95E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 7.47E-12 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 4.69E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 4.08E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 2.28E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.88E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.75E-17 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 4.47E-06 4.46E-06 mr1273_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 5.84E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 7.45E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 3.22E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.98E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 7.23E-13 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.03E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 8.08E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 4.46E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 2.27E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 5.37E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 5.50E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 2.21E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 6.28E-13 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118352952 NA 1.87E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251