\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118320073:

Variant ID: vg1118320073 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18320073
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAAATTAAATATGCATGTCTCGAGCCAACAATGTTCCGAGCTACAAACGGCAATAAAAAGTAATATTTACAGTTGCGATATACTATATCATGCATCTC[A/G]
CACCATTTCAATTACTCTAGCCTTAAATGGATCCATTGTACATTTCCCGAATAGTTCTATATTAACCTTCAAAAATTACAAGTACTTCTCTCTATGATGC

Reverse complement sequence

GCATCATAGAGAGAAGTACTTGTAATTTTTGAAGGTTAATATAGAACTATTCGGGAAATGTACAATGGATCCATTTAAGGCTAGAGTAATTGAAATGGTG[T/C]
GAGATGCATGATATAGTATATCGCAACTGTAAATATTACTTTTTATTGCCGTTTGTAGCTCGGAACATTGTTGGCTCGAGACATGCATATTTAATTTACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.40% 16.60% 0.02% 0.00% NA
All Indica  2759 83.70% 16.20% 0.04% 0.00% NA
All Japonica  1512 89.10% 10.90% 0.00% 0.00% NA
Aus  269 41.60% 58.40% 0.00% 0.00% NA
Indica I  595 51.60% 48.20% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 95.20% 4.80% 0.00% 0.00% NA
Indica Intermediate  786 85.90% 14.10% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 76.20% 23.80% 0.00% 0.00% NA
Japonica Intermediate  241 82.20% 17.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118320073 A -> G LOC_Os11g31400.1 upstream_gene_variant ; 1468.0bp to feature; MODIFIER silent_mutation Average:43.339; most accessible tissue: Callus, score: 85.251 N N N N
vg1118320073 A -> G LOC_Os11g31390.1 downstream_gene_variant ; 1302.0bp to feature; MODIFIER silent_mutation Average:43.339; most accessible tissue: Callus, score: 85.251 N N N N
vg1118320073 A -> G LOC_Os11g31390-LOC_Os11g31400 intergenic_region ; MODIFIER silent_mutation Average:43.339; most accessible tissue: Callus, score: 85.251 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118320073 NA 2.30E-06 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 1.15E-06 1.15E-06 mr1590 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 1.38E-06 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 7.56E-07 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 5.58E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 4.47E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 7.72E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 1.78E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 1.72E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 8.99E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 4.00E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118320073 NA 5.14E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251