\
| Variant ID: vg1118320073 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18320073 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 268. )
TGTAAATTAAATATGCATGTCTCGAGCCAACAATGTTCCGAGCTACAAACGGCAATAAAAAGTAATATTTACAGTTGCGATATACTATATCATGCATCTC[A/G]
CACCATTTCAATTACTCTAGCCTTAAATGGATCCATTGTACATTTCCCGAATAGTTCTATATTAACCTTCAAAAATTACAAGTACTTCTCTCTATGATGC
GCATCATAGAGAGAAGTACTTGTAATTTTTGAAGGTTAATATAGAACTATTCGGGAAATGTACAATGGATCCATTTAAGGCTAGAGTAATTGAAATGGTG[T/C]
GAGATGCATGATATAGTATATCGCAACTGTAAATATTACTTTTTATTGCCGTTTGTAGCTCGGAACATTGTTGGCTCGAGACATGCATATTTAATTTACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.40% | 16.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 83.70% | 16.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 89.10% | 10.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 41.60% | 58.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 51.60% | 48.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.20% | 23.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118320073 | A -> G | LOC_Os11g31400.1 | upstream_gene_variant ; 1468.0bp to feature; MODIFIER | silent_mutation | Average:43.339; most accessible tissue: Callus, score: 85.251 | N | N | N | N |
| vg1118320073 | A -> G | LOC_Os11g31390.1 | downstream_gene_variant ; 1302.0bp to feature; MODIFIER | silent_mutation | Average:43.339; most accessible tissue: Callus, score: 85.251 | N | N | N | N |
| vg1118320073 | A -> G | LOC_Os11g31390-LOC_Os11g31400 | intergenic_region ; MODIFIER | silent_mutation | Average:43.339; most accessible tissue: Callus, score: 85.251 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118320073 | NA | 2.30E-06 | mr1266 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | 1.15E-06 | 1.15E-06 | mr1590 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 1.38E-06 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 7.56E-07 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 5.58E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 4.47E-09 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 7.72E-06 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 1.78E-06 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 1.72E-07 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 8.99E-07 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 4.00E-06 | mr1722_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118320073 | NA | 5.14E-06 | mr1892_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |