\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118285234:

Variant ID: vg1118285234 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18285234
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTAGCTTCAAAAATTCAATGATTTGTTGATGCATGCTCACTCTTTTTATGTGGGTAGACCTAGTATGCACAATAGTATTTGGTGTATGCTACTTCCCT[A/T]
TCATCATTAAAAAAGGTTATCCTATACTTGTTATGATTGGAATGCTTAAATTTATATATGTTGGTCCCAACCTATCTTAGTAAGGCAGGCCGTATGTGAA

Reverse complement sequence

TTCACATACGGCCTGCCTTACTAAGATAGGTTGGGACCAACATATATAAATTTAAGCATTCCAATCATAACAAGTATAGGATAACCTTTTTTAATGATGA[T/A]
AGGGAAGTAGCATACACCAAATACTATTGTGCATACTAGGTCTACCCACATAAAAAGAGTGAGCATGCATCAACAAATCATTGAATTTTTGAAGCTACGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 2.90% 1.71% 0.00% NA
All Indica  2759 95.40% 4.10% 0.43% 0.00% NA
All Japonica  1512 94.00% 1.60% 4.43% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 83.20% 15.50% 1.34% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.40% 0.51% 0.00% NA
Temperate Japonica  767 88.30% 3.10% 8.60% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118285234 A -> T LOC_Os11g31330.1 upstream_gene_variant ; 3123.0bp to feature; MODIFIER silent_mutation Average:56.402; most accessible tissue: Minghui63 flower, score: 75.217 N N N N
vg1118285234 A -> T LOC_Os11g31320-LOC_Os11g31330 intergenic_region ; MODIFIER silent_mutation Average:56.402; most accessible tissue: Minghui63 flower, score: 75.217 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118285234 NA 1.61E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118285234 4.82E-06 4.83E-06 mr1273_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118285234 NA 3.27E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118285234 NA 1.21E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251