\
| Variant ID: vg1118246821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18246821 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATGGAAAGCTAACGAGACCAACTTTGGATCTGGTCCCACGCCAAATTCCTTCTGAGTCAACGGGAATCTTCGAAATAAGAAGGCATTCAGAATTTGTCC[G/A]
GGTGCTGTGTCACATCTTTGAGCCTGTTGGGCCGTGCGTCGTGTCGGGGTTTAATAGGGACGTGTCCAGGGGTCTAAGGTCGACCCTAGAACCTATATAT
ATATATAGGTTCTAGGGTCGACCTTAGACCCCTGGACACGTCCCTATTAAACCCCGACACGACGCACGGCCCAACAGGCTCAAAGATGTGACACAGCACC[C/T]
GGACAAATTCTGAATGCCTTCTTATTTCGAAGATTCCCGTTGACTCAGAAGGAATTTGGCGTGGGACCAGATCCAAAGTTGGTCTCGTTAGCTTTCCATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.40% | 0.40% | 3.20% | 24.99% | NA |
| All Indica | 2759 | 55.30% | 0.70% | 4.13% | 39.94% | NA |
| All Japonica | 1512 | 98.20% | 0.00% | 0.40% | 1.39% | NA |
| Aus | 269 | 98.10% | 0.00% | 0.37% | 1.49% | NA |
| Indica I | 595 | 81.00% | 0.00% | 0.84% | 18.15% | NA |
| Indica II | 465 | 49.00% | 0.00% | 5.59% | 45.38% | NA |
| Indica III | 913 | 42.10% | 1.10% | 5.15% | 51.70% | NA |
| Indica Intermediate | 786 | 54.80% | 1.00% | 4.58% | 39.57% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 98.40% | 0.00% | 0.20% | 1.39% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 2.07% | 2.07% | NA |
| VI/Aromatic | 96 | 39.60% | 1.00% | 25.00% | 34.38% | NA |
| Intermediate | 90 | 70.00% | 0.00% | 6.67% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118246821 | G -> A | LOC_Os11g31280.1 | upstream_gene_variant ; 624.0bp to feature; MODIFIER | silent_mutation | Average:43.56; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| vg1118246821 | G -> A | LOC_Os11g31260-LOC_Os11g31280 | intergenic_region ; MODIFIER | silent_mutation | Average:43.56; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| vg1118246821 | G -> DEL | N | N | silent_mutation | Average:43.56; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118246821 | NA | 5.46E-07 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118246821 | NA | 7.75E-07 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118246821 | NA | 3.43E-06 | mr1120_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118246821 | 5.86E-08 | 3.87E-08 | mr1240_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118246821 | NA | 8.73E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |