Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118190858:

Variant ID: vg1118190858 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 18190858
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

AACTTGTCTGTATTACACATTTCTCCCTTATTATACGAATACAAGGCCCTGCCTTAAACAAAAAGGGAAGGTGCTTAACATCGGTACATTGTACCCTCAA[T/C]
AGGAATCATCCATAAACATAGCAAGCTCACTGTTTATAGACATCAATATGTTTATTTATTATATGATCGCTGCAAACTTTCGATTACAGTGATAAGTAGC

Reverse complement sequence

GCTACTTATCACTGTAATCGAAAGTTTGCAGCGATCATATAATAAATAAACATATTGATGTCTATAAACAGTGAGCTTGCTATGTTTATGGATGATTCCT[A/G]
TTGAGGGTACAATGTACCGATGTTAAGCACCTTCCCTTTTTGTTTAAGGCAGGGCCTTGTATTCGTATAATAAGGGAGAAATGTGTAATACAGACAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.80%	4.10%	23.04%	42.02%	NA
All Indica	2759	14.20%	5.90%	26.93%	52.99%	NA
All Japonica	1512	59.80%	1.20%	19.31%	19.71%	NA
Aus	269	27.10%	0.00%	7.06%	65.80%	NA
Indica I	595	21.80%	4.20%	8.24%	65.71%	NA
Indica II	465	9.90%	20.60%	20.43%	49.03%	NA
Indica III	913	10.40%	0.00%	43.04%	46.55%	NA
Indica Intermediate	786	15.30%	5.30%	26.21%	53.18%	NA
Temperate Japonica	767	91.10%	1.60%	1.83%	5.48%	NA
Tropical Japonica	504	15.50%	0.80%	44.05%	39.68%	NA
Japonica Intermediate	241	52.70%	0.80%	23.24%	23.24%	NA
VI/Aromatic	96	67.70%	2.10%	9.38%	20.83%	NA
Intermediate	90	26.70%	12.20%	28.89%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1118190858	T -> DEL	N	N	silent_mutation	Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882	N	N	N	N
vg1118190858	T -> C	LOC_Os11g31200.1	downstream_gene_variant ; 4912.0bp to feature; MODIFIER	silent_mutation	Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882	N	N	N	N
vg1118190858	T -> C	LOC_Os11g31210.1	downstream_gene_variant ; 84.0bp to feature; MODIFIER	silent_mutation	Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882	N	N	N	N
vg1118190858	T -> C	LOC_Os11g31200-LOC_Os11g31210	intergenic_region ; MODIFIER	silent_mutation	Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1118190858	NA	5.72E-08	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858	NA	2.69E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858	NA	1.24E-07	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858	6.44E-06	6.46E-06	mr1273_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858	NA	2.06E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858	NA	7.75E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251