\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118190858:

Variant ID: vg1118190858 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18190858
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTGTCTGTATTACACATTTCTCCCTTATTATACGAATACAAGGCCCTGCCTTAAACAAAAAGGGAAGGTGCTTAACATCGGTACATTGTACCCTCAA[T/C]
AGGAATCATCCATAAACATAGCAAGCTCACTGTTTATAGACATCAATATGTTTATTTATTATATGATCGCTGCAAACTTTCGATTACAGTGATAAGTAGC

Reverse complement sequence

GCTACTTATCACTGTAATCGAAAGTTTGCAGCGATCATATAATAAATAAACATATTGATGTCTATAAACAGTGAGCTTGCTATGTTTATGGATGATTCCT[A/G]
TTGAGGGTACAATGTACCGATGTTAAGCACCTTCCCTTTTTGTTTAAGGCAGGGCCTTGTATTCGTATAATAAGGGAGAAATGTGTAATACAGACAAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.80% 4.10% 23.04% 42.02% NA
All Indica  2759 14.20% 5.90% 26.93% 52.99% NA
All Japonica  1512 59.80% 1.20% 19.31% 19.71% NA
Aus  269 27.10% 0.00% 7.06% 65.80% NA
Indica I  595 21.80% 4.20% 8.24% 65.71% NA
Indica II  465 9.90% 20.60% 20.43% 49.03% NA
Indica III  913 10.40% 0.00% 43.04% 46.55% NA
Indica Intermediate  786 15.30% 5.30% 26.21% 53.18% NA
Temperate Japonica  767 91.10% 1.60% 1.83% 5.48% NA
Tropical Japonica  504 15.50% 0.80% 44.05% 39.68% NA
Japonica Intermediate  241 52.70% 0.80% 23.24% 23.24% NA
VI/Aromatic  96 67.70% 2.10% 9.38% 20.83% NA
Intermediate  90 26.70% 12.20% 28.89% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118190858 T -> DEL N N silent_mutation Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882 N N N N
vg1118190858 T -> C LOC_Os11g31200.1 downstream_gene_variant ; 4912.0bp to feature; MODIFIER silent_mutation Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882 N N N N
vg1118190858 T -> C LOC_Os11g31210.1 downstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882 N N N N
vg1118190858 T -> C LOC_Os11g31200-LOC_Os11g31210 intergenic_region ; MODIFIER silent_mutation Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118190858 NA 5.72E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858 NA 2.69E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858 NA 1.24E-07 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858 6.44E-06 6.46E-06 mr1273_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858 NA 2.06E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118190858 NA 7.75E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251