\
| Variant ID: vg1118190858 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18190858 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 76. )
AACTTGTCTGTATTACACATTTCTCCCTTATTATACGAATACAAGGCCCTGCCTTAAACAAAAAGGGAAGGTGCTTAACATCGGTACATTGTACCCTCAA[T/C]
AGGAATCATCCATAAACATAGCAAGCTCACTGTTTATAGACATCAATATGTTTATTTATTATATGATCGCTGCAAACTTTCGATTACAGTGATAAGTAGC
GCTACTTATCACTGTAATCGAAAGTTTGCAGCGATCATATAATAAATAAACATATTGATGTCTATAAACAGTGAGCTTGCTATGTTTATGGATGATTCCT[A/G]
TTGAGGGTACAATGTACCGATGTTAAGCACCTTCCCTTTTTGTTTAAGGCAGGGCCTTGTATTCGTATAATAAGGGAGAAATGTGTAATACAGACAAGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.80% | 4.10% | 23.04% | 42.02% | NA |
| All Indica | 2759 | 14.20% | 5.90% | 26.93% | 52.99% | NA |
| All Japonica | 1512 | 59.80% | 1.20% | 19.31% | 19.71% | NA |
| Aus | 269 | 27.10% | 0.00% | 7.06% | 65.80% | NA |
| Indica I | 595 | 21.80% | 4.20% | 8.24% | 65.71% | NA |
| Indica II | 465 | 9.90% | 20.60% | 20.43% | 49.03% | NA |
| Indica III | 913 | 10.40% | 0.00% | 43.04% | 46.55% | NA |
| Indica Intermediate | 786 | 15.30% | 5.30% | 26.21% | 53.18% | NA |
| Temperate Japonica | 767 | 91.10% | 1.60% | 1.83% | 5.48% | NA |
| Tropical Japonica | 504 | 15.50% | 0.80% | 44.05% | 39.68% | NA |
| Japonica Intermediate | 241 | 52.70% | 0.80% | 23.24% | 23.24% | NA |
| VI/Aromatic | 96 | 67.70% | 2.10% | 9.38% | 20.83% | NA |
| Intermediate | 90 | 26.70% | 12.20% | 28.89% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118190858 | T -> DEL | N | N | silent_mutation | Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882 | N | N | N | N |
| vg1118190858 | T -> C | LOC_Os11g31200.1 | downstream_gene_variant ; 4912.0bp to feature; MODIFIER | silent_mutation | Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882 | N | N | N | N |
| vg1118190858 | T -> C | LOC_Os11g31210.1 | downstream_gene_variant ; 84.0bp to feature; MODIFIER | silent_mutation | Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882 | N | N | N | N |
| vg1118190858 | T -> C | LOC_Os11g31200-LOC_Os11g31210 | intergenic_region ; MODIFIER | silent_mutation | Average:19.193; most accessible tissue: Minghui63 flag leaf, score: 32.882 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118190858 | NA | 5.72E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118190858 | NA | 2.69E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118190858 | NA | 1.24E-07 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118190858 | 6.44E-06 | 6.46E-06 | mr1273_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118190858 | NA | 2.06E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118190858 | NA | 7.75E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |