\
| Variant ID: vg1118177146 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18177146 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GATATAAATGCAATGGCGATGAGACCAGAGTGTTTTTCTGTTTGTGGTAGCAACAAACTGGAAGAGCACTATATAACCTCTGAACTAATATGCAATTAAA[G/C]
GTGATTAACTCACTAAGGATAAAATTACCTTTTTAAAATAACATTTATGATGTTAGGCCATTCATCTTCTTTAAAATCCTTAAAATCCATGCAGATTTTT
AAAAATCTGCATGGATTTTAAGGATTTTAAAGAAGATGAATGGCCTAACATCATAAATGTTATTTTAAAAAGGTAATTTTATCCTTAGTGAGTTAATCAC[C/G]
TTTAATTGCATATTAGTTCAGAGGTTATATAGTGCTCTTCCAGTTTGTTGCTACCACAAACAGAAAAACACTCTGGTCTCATCGCCATTGCATTTATATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.20% | 29.00% | 21.65% | 18.18% | NA |
| All Indica | 2759 | 18.80% | 30.20% | 23.81% | 27.22% | NA |
| All Japonica | 1512 | 57.10% | 22.90% | 15.67% | 4.30% | NA |
| Aus | 269 | 11.20% | 57.60% | 26.77% | 4.46% | NA |
| Indica I | 595 | 25.20% | 20.20% | 23.87% | 30.76% | NA |
| Indica II | 465 | 31.40% | 23.00% | 12.04% | 33.55% | NA |
| Indica III | 913 | 9.90% | 41.10% | 28.92% | 20.15% | NA |
| Indica Intermediate | 786 | 16.80% | 29.40% | 24.81% | 29.01% | NA |
| Temperate Japonica | 767 | 95.30% | 1.80% | 1.96% | 0.91% | NA |
| Tropical Japonica | 504 | 5.60% | 57.90% | 27.38% | 9.13% | NA |
| Japonica Intermediate | 241 | 43.60% | 16.60% | 34.85% | 4.98% | NA |
| VI/Aromatic | 96 | 33.30% | 8.30% | 43.75% | 14.58% | NA |
| Intermediate | 90 | 33.30% | 31.10% | 16.67% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118177146 | G -> DEL | N | N | silent_mutation | Average:28.227; most accessible tissue: Callus, score: 39.874 | N | N | N | N |
| vg1118177146 | G -> C | LOC_Os11g31190.1 | upstream_gene_variant ; 2668.0bp to feature; MODIFIER | silent_mutation | Average:28.227; most accessible tissue: Callus, score: 39.874 | N | N | N | N |
| vg1118177146 | G -> C | LOC_Os11g31190-LOC_Os11g31200 | intergenic_region ; MODIFIER | silent_mutation | Average:28.227; most accessible tissue: Callus, score: 39.874 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118177146 | NA | 6.08E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 7.05E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 7.06E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 5.93E-07 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 2.01E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 1.55E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 5.34E-08 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 4.53E-21 | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 8.99E-10 | mr1159_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 5.71E-06 | mr1159_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 6.99E-06 | mr1186_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 7.68E-06 | mr1267_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 1.03E-09 | mr1352_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 2.03E-07 | mr1359_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 6.32E-07 | mr1359_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 1.13E-09 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 5.61E-07 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 5.52E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 6.25E-09 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 7.37E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 3.23E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 5.57E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 3.48E-06 | mr1647_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 2.14E-07 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 9.50E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 2.62E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 1.97E-07 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 8.57E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 4.52E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 1.85E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 1.01E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 6.34E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 4.02E-11 | mr1864_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 3.11E-06 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118177146 | NA | 5.77E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |