\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118177146:

Variant ID: vg1118177146 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18177146
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATATAAATGCAATGGCGATGAGACCAGAGTGTTTTTCTGTTTGTGGTAGCAACAAACTGGAAGAGCACTATATAACCTCTGAACTAATATGCAATTAAA[G/C]
GTGATTAACTCACTAAGGATAAAATTACCTTTTTAAAATAACATTTATGATGTTAGGCCATTCATCTTCTTTAAAATCCTTAAAATCCATGCAGATTTTT

Reverse complement sequence

AAAAATCTGCATGGATTTTAAGGATTTTAAAGAAGATGAATGGCCTAACATCATAAATGTTATTTTAAAAAGGTAATTTTATCCTTAGTGAGTTAATCAC[C/G]
TTTAATTGCATATTAGTTCAGAGGTTATATAGTGCTCTTCCAGTTTGTTGCTACCACAAACAGAAAAACACTCTGGTCTCATCGCCATTGCATTTATATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.20% 29.00% 21.65% 18.18% NA
All Indica  2759 18.80% 30.20% 23.81% 27.22% NA
All Japonica  1512 57.10% 22.90% 15.67% 4.30% NA
Aus  269 11.20% 57.60% 26.77% 4.46% NA
Indica I  595 25.20% 20.20% 23.87% 30.76% NA
Indica II  465 31.40% 23.00% 12.04% 33.55% NA
Indica III  913 9.90% 41.10% 28.92% 20.15% NA
Indica Intermediate  786 16.80% 29.40% 24.81% 29.01% NA
Temperate Japonica  767 95.30% 1.80% 1.96% 0.91% NA
Tropical Japonica  504 5.60% 57.90% 27.38% 9.13% NA
Japonica Intermediate  241 43.60% 16.60% 34.85% 4.98% NA
VI/Aromatic  96 33.30% 8.30% 43.75% 14.58% NA
Intermediate  90 33.30% 31.10% 16.67% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118177146 G -> DEL N N silent_mutation Average:28.227; most accessible tissue: Callus, score: 39.874 N N N N
vg1118177146 G -> C LOC_Os11g31190.1 upstream_gene_variant ; 2668.0bp to feature; MODIFIER silent_mutation Average:28.227; most accessible tissue: Callus, score: 39.874 N N N N
vg1118177146 G -> C LOC_Os11g31190-LOC_Os11g31200 intergenic_region ; MODIFIER silent_mutation Average:28.227; most accessible tissue: Callus, score: 39.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118177146 NA 6.08E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 7.05E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 7.06E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 5.93E-07 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 2.01E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 1.55E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 5.34E-08 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 4.53E-21 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 8.99E-10 mr1159_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 5.71E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 6.99E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 7.68E-06 mr1267_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 1.03E-09 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 2.03E-07 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 6.32E-07 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 1.13E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 5.61E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 5.52E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 6.25E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 7.37E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 3.23E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 5.57E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 3.48E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 2.14E-07 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 9.50E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 2.62E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 1.97E-07 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 8.57E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 4.52E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 1.85E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 1.01E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 6.34E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 4.02E-11 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 3.11E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118177146 NA 5.77E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251