\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118170898:

Variant ID: vg1118170898 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18170898
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCCTGCAAGAGCCAGGAATGTTGGGCCGCGGTTGTGCCGATTGTTGGACCATGCCGTGCTGGGCTGGCATGTCGTGTCAAGTAAGAGACCCAGAAACG[G/A]
CCCGACGGTCGGGTCGGGTCGGGCCAGCACAGGCCTAACAACAGTCGAGCCGTGTCGTGTCTGGGCTGGGCCAAATCTTCATACCATGGGTCGGGCCGTC

Reverse complement sequence

GACGGCCCGACCCATGGTATGAAGATTTGGCCCAGCCCAGACACGACACGGCTCGACTGTTGTTAGGCCTGTGCTGGCCCGACCCGACCCGACCGTCGGG[C/T]
CGTTTCTGGGTCTCTTACTTGACACGACATGCCAGCCCAGCACGGCATGGTCCAACAATCGGCACAACCGCGGCCCAACATTCCTGGCTCTTGCAGGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 11.90% 0.89% 0.00% NA
All Indica  2759 87.50% 11.70% 0.76% 0.00% NA
All Japonica  1512 98.10% 0.70% 1.19% 0.00% NA
Aus  269 31.60% 67.30% 1.12% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 96.60% 1.50% 1.94% 0.00% NA
Indica III  913 77.30% 22.30% 0.33% 0.00% NA
Indica Intermediate  786 86.00% 13.00% 1.02% 0.00% NA
Temperate Japonica  767 97.90% 0.00% 2.09% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.41% 0.00% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118170898 G -> A LOC_Os11g31190.1 downstream_gene_variant ; 780.0bp to feature; MODIFIER silent_mutation Average:97.836; most accessible tissue: Minghui63 root, score: 99.988 N N N N
vg1118170898 G -> A LOC_Os11g31180-LOC_Os11g31190 intergenic_region ; MODIFIER silent_mutation Average:97.836; most accessible tissue: Minghui63 root, score: 99.988 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1118170898 G A -0.04 -0.04 -0.04 -0.02 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118170898 NA 2.57E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118170898 NA 2.03E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118170898 NA 3.59E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118170898 NA 5.29E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118170898 NA 6.01E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118170898 NA 9.55E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118170898 NA 2.87E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118170898 NA 1.27E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118170898 4.65E-07 4.65E-07 mr1866 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251