\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118128662:

Variant ID: vg1118128662 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 18128662
Reference Allele: TAlternative Allele: C,TC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.38, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGGCGAAAGCTCTGCCTGATCTTCCAGGTTCGGTAACATGGACACCTGCGGGTGCCGTTTCCTCCTTGGAGGTGTTGCTTCGTAGACTCTCTCTCTTT[T/C,TC]
GGGGTGAAAACCCAATCTAGTTTTTGGGCGGGCGTCGGCAGCGGCTTTTGCCGTTGTTCACTCCTTGGAGGCTTTGCCTTGAAGGTCTTGCTCTTCTTTT

Reverse complement sequence

AAAAGAAGAGCAAGACCTTCAAGGCAAAGCCTCCAAGGAGTGAACAACGGCAAAAGCCGCTGCCGACGCCCGCCCAAAAACTAGATTGGGTTTTCACCCC[A/G,GA]
AAAGAGAGAGAGTCTACGAAGCAACACCTCCAAGGAGGAAACGGCACCCGCAGGTGTCCATGTTACCGAACCTGGAAGATCAGGCAGAGCTTTCGCCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 23.70% 0.06% 0.63% TC: 12.65%
All Indica  2759 76.80% 8.50% 0.07% 0.36% TC: 14.28%
All Japonica  1512 44.80% 53.40% 0.00% 1.12% TC: 0.66%
Aus  269 15.20% 14.10% 0.37% 1.12% TC: 69.14%
Indica I  595 79.30% 18.70% 0.17% 0.00% TC: 1.85%
Indica II  465 88.00% 6.70% 0.00% 1.94% TC: 3.44%
Indica III  913 69.20% 3.50% 0.11% 0.00% TC: 27.16%
Indica Intermediate  786 77.10% 7.60% 0.00% 0.13% TC: 15.14%
Temperate Japonica  767 5.20% 92.20% 0.00% 2.22% TC: 0.39%
Tropical Japonica  504 95.80% 3.80% 0.00% 0.00% TC: 0.40%
Japonica Intermediate  241 64.30% 33.60% 0.00% 0.00% TC: 2.07%
VI/Aromatic  96 63.50% 30.20% 0.00% 0.00% TC: 6.25%
Intermediate  90 84.40% 13.30% 0.00% 0.00% TC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118128662 T -> TC LOC_Os11g31150.1 upstream_gene_variant ; 3666.0bp to feature; MODIFIER silent_mutation Average:62.033; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg1118128662 T -> TC LOC_Os11g31140.1 intron_variant ; MODIFIER silent_mutation Average:62.033; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg1118128662 T -> DEL N N silent_mutation Average:62.033; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg1118128662 T -> C LOC_Os11g31150.1 upstream_gene_variant ; 3667.0bp to feature; MODIFIER silent_mutation Average:62.033; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg1118128662 T -> C LOC_Os11g31140.1 intron_variant ; MODIFIER silent_mutation Average:62.033; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118128662 NA 6.82E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 1.40E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 7.17E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 1.61E-17 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 1.97E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 5.51E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 1.37E-14 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 8.85E-12 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 8.88E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 2.02E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 7.27E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 8.90E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 1.57E-17 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 3.33E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 8.42E-14 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 3.11E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 3.42E-06 8.99E-12 mr1471_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 1.16E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 4.15E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 2.23E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 9.44E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 2.03E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 4.74E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 1.75E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 3.70E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 2.11E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 1.13E-06 1.95E-07 mr1815_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 2.94E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 4.45E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 8.05E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 3.37E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128662 NA 3.43E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251