\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118128320:

Variant ID: vg1118128320 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18128320
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, T: 0.14, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCTCCACTCCTTGATGCTCCTCCCTTGTCTTGGCTGTCTGTTTCTAGACCCGGCCGTGGAGTCTTTTGGTGGTTGAGGAGATTTGTTCGTCCGCGTTG[T/G]
TGGTCCAGTCTGTCTATAGTTAGGGCTCTTGGGCCTCGCCGGTGCTTCATGCCCCCTGTGGCTGTGTAAACCTGTAGTTTTGCCGAGTGTGGAGTGGTGT

Reverse complement sequence

ACACCACTCCACACTCGGCAAAACTACAGGTTTACACAGCCACAGGGGGCATGAAGCACCGGCGAGGCCCAAGAGCCCTAACTATAGACAGACTGGACCA[A/C]
CAACGCGGACGAACAAATCTCCTCAACCACCAAAAGACTCCACGGCCGGGTCTAGAAACAGACAGCCAAGACAAGGGAGGAGCATCAAGGAGTGGAGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 30.70% 0.08% 0.63% NA
All Indica  2759 79.80% 19.80% 0.04% 0.36% NA
All Japonica  1512 45.80% 53.00% 0.13% 1.12% NA
Aus  269 77.00% 21.90% 0.00% 1.12% NA
Indica I  595 80.70% 19.30% 0.00% 0.00% NA
Indica II  465 89.90% 8.20% 0.00% 1.94% NA
Indica III  913 73.50% 26.50% 0.00% 0.00% NA
Indica Intermediate  786 80.50% 19.20% 0.13% 0.13% NA
Temperate Japonica  767 6.30% 91.40% 0.13% 2.22% NA
Tropical Japonica  504 96.00% 3.80% 0.20% 0.00% NA
Japonica Intermediate  241 66.40% 33.60% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118128320 T -> DEL LOC_Os11g31140.1 N frameshift_variant Average:71.709; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg1118128320 T -> G LOC_Os11g31140.1 missense_variant ; p.Thr103Pro; MODERATE nonsynonymous_codon ; T103P Average:71.709; most accessible tissue: Minghui63 flag leaf, score: 80.786 possibly damaging -1.642 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118128320 NA 1.03E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1118128320 NA 4.59E-17 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 2.81E-14 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 1.08E-11 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 5.48E-06 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 1.98E-09 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 6.32E-16 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 5.57E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 6.60E-06 NA mr1186_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 1.52E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 3.06E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 8.32E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 3.54E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 1.01E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 7.71E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 1.48E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 8.61E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 2.47E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 6.96E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 2.30E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 3.22E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 1.89E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 5.77E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 8.15E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118128320 NA 6.58E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251