Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1118063449:

Variant ID: vg1118063449 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 18063449
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCAGGATTTGCAGACGGAGGTCGGCGATCTTCGTCAACAGCTGAACCTCATCGGCAAGGCTACTCCGGCTTCCCCGACGACGTCTTCCCCTCGAGTCCC[G/A]
TTGACGGGCGAGGAAAGGAAGGCGCCGCTGCTGCCTACGCCATCACCTTCGTTTCACTTGGCTGCAGCAGAGGAAGGAAGCAAAGGGGCCATTGGCCACA

Reverse complement sequence

TGTGGCCAATGGCCCCTTTGCTTCCTTCCTCTGCTGCAGCCAAGTGAAACGAAGGTGATGGCGTAGGCAGCAGCGGCGCCTTCCTTTCCTCGCCCGTCAA[C/T]
GGGACTCGAGGGGAAGACGTCGTCGGGGAAGCCGGAGTAGCCTTGCCGATGAGGTTCAGCTGTTGACGAAGATCGCCGACCTCCGTCTGCAAATCCTGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	7.90%	0.02%	1.29%	NA
All Indica	2759	97.80%	0.50%	0.04%	1.74%	NA
All Japonica	1512	76.80%	23.20%	0.00%	0.00%	NA
Aus	269	93.70%	1.50%	0.00%	4.83%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.00%	0.00%	0.65%	NA
Indica III	913	94.10%	1.10%	0.11%	4.71%	NA
Indica Intermediate	786	99.40%	0.40%	0.00%	0.25%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	59.30%	40.70%	0.00%	0.00%	NA
Japonica Intermediate	241	46.90%	53.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1118063449	G -> A	LOC_Os11g31050.1	upstream_gene_variant ; 196.0bp to feature; MODIFIER	silent_mutation	Average:69.589; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg1118063449	G -> A	LOC_Os11g31040-LOC_Os11g31050	intergenic_region ; MODIFIER	silent_mutation	Average:69.589; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg1118063449	G -> DEL	N	N	silent_mutation	Average:69.589; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1118063449	NA	1.17E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	3.90E-07	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	1.97E-11	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	5.91E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	1.89E-08	2.23E-25	mr1042_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	1.45E-09	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	4.80E-06	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	3.01E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	1.48E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	3.35E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	7.40E-08	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	9.56E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	4.16E-06	3.51E-13	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	2.45E-09	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	1.37E-06	1.53E-14	mr1543_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	1.38E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	3.33E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	9.76E-06	mr1621_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	2.76E-06	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	6.47E-08	7.77E-17	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	2.25E-08	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	3.03E-06	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	7.64E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	1.23E-06	1.31E-17	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	3.54E-06	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	1.32E-09	1.24E-29	mr1871_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	4.72E-10	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	6.30E-06	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118063449	NA	7.44E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251