\
| Variant ID: vg1118024765 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18024765 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTCGAACGTCTCCTACAGGTCGATCGCATGGTCGAAAGCCTTACGGCTTTTTACGACGAAGTCGTCGACGTAAGCTTCCACATTCCGCCCCAACTGCTT[G/A]
CCAAGGACCTTGTACACCAGCCTGGCGAAAGTTGCTAATGCATTCCTTAAGCCGAAAGGCATCCTGAGGTGACAAAATGTGCCGAATAGAGTGATGAAGG
CCTTCATCACTCTATTCGGCACATTTTGTCACCTCAGGATGCCTTTCGGCTTAAGGAATGCATTAGCAACTTTCGCCAGGCTGGTGTACAAGGTCCTTGG[C/T]
AAGCAGTTGGGGCGGAATGTGGAAGCTTACGTCGACGACTTCGTCGTAAAAAGCCGTAAGGCTTTCGACCATGCGATCGACCTGTAGGAGACGTTCGACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 0.10% | 4.70% | 12.63% | NA |
| All Indica | 2759 | 80.40% | 0.10% | 4.35% | 15.19% | NA |
| All Japonica | 1512 | 84.30% | 0.10% | 6.48% | 9.19% | NA |
| Aus | 269 | 97.00% | 0.00% | 0.00% | 2.97% | NA |
| Indica I | 595 | 64.90% | 0.00% | 10.59% | 24.54% | NA |
| Indica II | 465 | 88.20% | 0.20% | 0.86% | 10.75% | NA |
| Indica III | 913 | 87.80% | 0.00% | 2.08% | 10.08% | NA |
| Indica Intermediate | 786 | 78.80% | 0.30% | 4.33% | 16.67% | NA |
| Temperate Japonica | 767 | 98.00% | 0.00% | 1.04% | 0.91% | NA |
| Tropical Japonica | 504 | 73.20% | 0.20% | 12.90% | 13.69% | NA |
| Japonica Intermediate | 241 | 63.50% | 0.00% | 10.37% | 26.14% | NA |
| VI/Aromatic | 96 | 74.00% | 0.00% | 0.00% | 26.04% | NA |
| Intermediate | 90 | 88.90% | 0.00% | 4.44% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118024765 | G -> A | LOC_Os11g30990.1 | synonymous_variant ; p.Gly969Gly; LOW | synonymous_codon | Average:13.336; most accessible tissue: Callus, score: 24.299 | N | N | N | N |
| vg1118024765 | G -> DEL | LOC_Os11g30990.1 | N | frameshift_variant | Average:13.336; most accessible tissue: Callus, score: 24.299 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118024765 | NA | 9.35E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118024765 | 4.53E-06 | 4.49E-06 | mr1058_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118024765 | 2.39E-06 | 1.65E-06 | mr1147_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118024765 | 9.25E-06 | 5.16E-06 | mr1302_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |