\
| Variant ID: vg1118023819 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18023819 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )
GGCGCCGGACTCCCAGCGCTTTCGCCTTTCTTAGGCCCAGGAGAACGGCTTCGTATTCTGCTGCATTGTTGGTTGTGTCGAATTGTAATCTCGCTGCGTA[C/T]
CGAATCGGCACACCATTCGGCGAAAAGAGGACTGCTGCAACGCCTGCCCCCTTGTGCGACCACTAACCGTCAGAGCACATCACCCAGAACTGGTCGTCGG
CCGACGACCAGTTCTGGGTGATGTGCTCTGACGGTTAGTGGTCGCACAAGGGGGCAGGCGTTGCAGCAGTCCTCTTTTCGCCGAATGGTGTGCCGATTCG[G/A]
TACGCAGCGAGATTACAATTCGACACAACCAACAATGCAGCAGAATACGAAGCCGTTCTCCTGGGCCTAAGAAAGGCGAAAGCGCTGGGAGTCCGGCGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 0.10% | 46.09% | 14.07% | NA |
| All Indica | 2759 | 23.10% | 0.10% | 59.15% | 17.62% | NA |
| All Japonica | 1512 | 70.80% | 0.00% | 21.43% | 7.74% | NA |
| Aus | 269 | 25.70% | 0.40% | 66.91% | 7.06% | NA |
| Indica I | 595 | 32.60% | 0.30% | 36.81% | 30.25% | NA |
| Indica II | 465 | 29.50% | 0.20% | 56.99% | 13.33% | NA |
| Indica III | 913 | 12.60% | 0.00% | 74.26% | 13.14% | NA |
| Indica Intermediate | 786 | 24.30% | 0.10% | 59.80% | 15.78% | NA |
| Temperate Japonica | 767 | 94.30% | 0.00% | 4.04% | 1.69% | NA |
| Tropical Japonica | 504 | 49.00% | 0.00% | 40.28% | 10.71% | NA |
| Japonica Intermediate | 241 | 41.90% | 0.00% | 37.34% | 20.75% | NA |
| VI/Aromatic | 96 | 59.40% | 0.00% | 8.33% | 32.29% | NA |
| Intermediate | 90 | 48.90% | 0.00% | 37.78% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118023819 | C -> T | LOC_Os11g30990.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:12.313; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg1118023819 | C -> T | LOC_Os11g30980.1 | upstream_gene_variant ; 1024.0bp to feature; MODIFIER | silent_mutation | Average:12.313; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg1118023819 | C -> T | LOC_Os11g30970.1 | downstream_gene_variant ; 3097.0bp to feature; MODIFIER | silent_mutation | Average:12.313; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg1118023819 | C -> DEL | N | N | silent_mutation | Average:12.313; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118023819 | 7.18E-06 | 7.18E-06 | mr1929 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118023819 | NA | 3.07E-09 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118023819 | 9.18E-06 | 9.18E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118023819 | NA | 2.76E-08 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118023819 | NA | 4.43E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118023819 | NA | 9.39E-06 | mr1665_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118023819 | NA | 5.06E-08 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118023819 | NA | 7.40E-06 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118023819 | NA | 6.01E-10 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118023819 | NA | 3.46E-09 | mr1929_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |