\
| Variant ID: vg1118022184 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 18022184 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCAGGCCTCCATGGTGGATAATAGCCCTACATCCAGTTTTTTTTTCTTTTTCTCTTCTCTTTGTTGCTCTTTTTTTTTCTTGCCGAAAGGCTTACATGA[C/A]
AATATGTACATTTTTACAAGTTGGCGATTTGGGTGCCAGCCATTCTAGACATAGAAGCGCTTGAGGGAGGCGGCGTTCCAGGAATGGTCGAACTCCTCAC
GTGAGGAGTTCGACCATTCCTGGAACGCCGCCTCCCTCAAGCGCTTCTATGTCTAGAATGGCTGGCACCCAAATCGCCAACTTGTAAAAATGTACATATT[G/T]
TCATGTAAGCCTTTCGGCAAGAAAAAAAAAGAGCAACAAAGAGAAGAGAAAAAGAAAAAAAAACTGGATGTAGGGCTATTATCCACCATGGAGGCCTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.50% | 25.30% | 29.56% | 9.61% | NA |
| All Indica | 2759 | 17.30% | 41.00% | 40.41% | 1.27% | NA |
| All Japonica | 1512 | 69.90% | 0.70% | 2.78% | 26.59% | NA |
| Aus | 269 | 22.30% | 13.80% | 61.34% | 2.60% | NA |
| Indica I | 595 | 26.40% | 46.20% | 26.89% | 0.50% | NA |
| Indica II | 465 | 28.60% | 24.70% | 43.87% | 2.80% | NA |
| Indica III | 913 | 4.80% | 48.30% | 46.00% | 0.88% | NA |
| Indica Intermediate | 786 | 18.30% | 38.20% | 42.11% | 1.40% | NA |
| Temperate Japonica | 767 | 93.90% | 0.40% | 1.43% | 4.30% | NA |
| Tropical Japonica | 504 | 47.60% | 0.40% | 4.17% | 47.82% | NA |
| Japonica Intermediate | 241 | 40.20% | 2.50% | 4.15% | 53.11% | NA |
| VI/Aromatic | 96 | 43.80% | 3.10% | 51.04% | 2.08% | NA |
| Intermediate | 90 | 44.40% | 17.80% | 28.89% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1118022184 | C -> A | LOC_Os11g30970.1 | downstream_gene_variant ; 1462.0bp to feature; MODIFIER | silent_mutation | Average:16.299; most accessible tissue: Zhenshan97 root, score: 25.639 | N | N | N | N |
| vg1118022184 | C -> A | LOC_Os11g30980.1 | downstream_gene_variant ; 165.0bp to feature; MODIFIER | silent_mutation | Average:16.299; most accessible tissue: Zhenshan97 root, score: 25.639 | N | N | N | N |
| vg1118022184 | C -> A | LOC_Os11g30990.1 | downstream_gene_variant ; 1134.0bp to feature; MODIFIER | silent_mutation | Average:16.299; most accessible tissue: Zhenshan97 root, score: 25.639 | N | N | N | N |
| vg1118022184 | C -> A | LOC_Os11g30970-LOC_Os11g30980 | intergenic_region ; MODIFIER | silent_mutation | Average:16.299; most accessible tissue: Zhenshan97 root, score: 25.639 | N | N | N | N |
| vg1118022184 | C -> DEL | N | N | silent_mutation | Average:16.299; most accessible tissue: Zhenshan97 root, score: 25.639 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1118022184 | 2.97E-06 | 2.98E-06 | mr1582 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118022184 | NA | 6.53E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118022184 | NA | 9.69E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1118022184 | NA | 1.71E-07 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |