| Variant ID: vg1117997623 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17997623 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.06, others allele: 0.00, population size: 103. )
GGTCCGAAATTTTGAACAAAATTTAGTTGAATTTAAATAAATATTACCCAAATTCATCAAAAAGTTGAAAAATTCAAAAATTTCAGCCGAATTAATATCG[A/T]
ATCGGAGGGACCGAAATGATCGAAATTTCAGAAATTTTGGTCCGAAATTTCCAACCCTGATGCCGCTGGCTTGACCCGCGAGCCGAAGAGCTTGGAAACT
AGTTTCCAAGCTCTTCGGCTCGCGGGTCAAGCCAGCGGCATCAGGGTTGGAAATTTCGGACCAAAATTTCTGAAATTTCGATCATTTCGGTCCCTCCGAT[T/A]
CGATATTAATTCGGCTGAAATTTTTGAATTTTTCAACTTTTTGATGAATTTGGGTAATATTTATTTAAATTCAACTAAATTTTGTTCAAAATTTCGGACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.10% | 16.30% | 0.74% | 53.81% | NA |
| All Indica | 2759 | 8.00% | 13.40% | 0.83% | 77.78% | NA |
| All Japonica | 1512 | 68.50% | 24.90% | 0.13% | 6.48% | NA |
| Aus | 269 | 15.20% | 1.50% | 1.12% | 82.16% | NA |
| Indica I | 595 | 18.70% | 12.40% | 0.67% | 68.24% | NA |
| Indica II | 465 | 2.20% | 23.20% | 1.29% | 73.33% | NA |
| Indica III | 913 | 4.10% | 10.60% | 0.11% | 85.21% | NA |
| Indica Intermediate | 786 | 8.00% | 11.50% | 1.53% | 79.01% | NA |
| Temperate Japonica | 767 | 92.60% | 4.00% | 0.00% | 3.39% | NA |
| Tropical Japonica | 504 | 46.20% | 42.30% | 0.20% | 11.31% | NA |
| Japonica Intermediate | 241 | 38.60% | 54.80% | 0.41% | 6.22% | NA |
| VI/Aromatic | 96 | 58.30% | 2.10% | 4.17% | 35.42% | NA |
| Intermediate | 90 | 24.40% | 23.30% | 3.33% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117997623 | A -> T | LOC_Os11g30930.1 | upstream_gene_variant ; 939.0bp to feature; MODIFIER | silent_mutation | Average:7.597; most accessible tissue: Callus, score: 28.869 | N | N | N | N |
| vg1117997623 | A -> T | LOC_Os11g30940.1 | upstream_gene_variant ; 709.0bp to feature; MODIFIER | silent_mutation | Average:7.597; most accessible tissue: Callus, score: 28.869 | N | N | N | N |
| vg1117997623 | A -> T | LOC_Os11g30920.1 | downstream_gene_variant ; 3775.0bp to feature; MODIFIER | silent_mutation | Average:7.597; most accessible tissue: Callus, score: 28.869 | N | N | N | N |
| vg1117997623 | A -> T | LOC_Os11g30950.1 | downstream_gene_variant ; 4432.0bp to feature; MODIFIER | silent_mutation | Average:7.597; most accessible tissue: Callus, score: 28.869 | N | N | N | N |
| vg1117997623 | A -> T | LOC_Os11g30930-LOC_Os11g30940 | intergenic_region ; MODIFIER | silent_mutation | Average:7.597; most accessible tissue: Callus, score: 28.869 | N | N | N | N |
| vg1117997623 | A -> DEL | N | N | silent_mutation | Average:7.597; most accessible tissue: Callus, score: 28.869 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117997623 | NA | 1.35E-08 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117997623 | NA | 3.07E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117997623 | NA | 1.53E-06 | mr1417_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117997623 | NA | 6.55E-08 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117997623 | NA | 8.36E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117997623 | 3.48E-06 | 3.47E-06 | mr1634_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117997623 | NA | 2.27E-07 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117997623 | NA | 1.62E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |