\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117997623:

Variant ID: vg1117997623 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17997623
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.06, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCCGAAATTTTGAACAAAATTTAGTTGAATTTAAATAAATATTACCCAAATTCATCAAAAAGTTGAAAAATTCAAAAATTTCAGCCGAATTAATATCG[A/T]
ATCGGAGGGACCGAAATGATCGAAATTTCAGAAATTTTGGTCCGAAATTTCCAACCCTGATGCCGCTGGCTTGACCCGCGAGCCGAAGAGCTTGGAAACT

Reverse complement sequence

AGTTTCCAAGCTCTTCGGCTCGCGGGTCAAGCCAGCGGCATCAGGGTTGGAAATTTCGGACCAAAATTTCTGAAATTTCGATCATTTCGGTCCCTCCGAT[T/A]
CGATATTAATTCGGCTGAAATTTTTGAATTTTTCAACTTTTTGATGAATTTGGGTAATATTTATTTAAATTCAACTAAATTTTGTTCAAAATTTCGGACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.10% 16.30% 0.74% 53.81% NA
All Indica  2759 8.00% 13.40% 0.83% 77.78% NA
All Japonica  1512 68.50% 24.90% 0.13% 6.48% NA
Aus  269 15.20% 1.50% 1.12% 82.16% NA
Indica I  595 18.70% 12.40% 0.67% 68.24% NA
Indica II  465 2.20% 23.20% 1.29% 73.33% NA
Indica III  913 4.10% 10.60% 0.11% 85.21% NA
Indica Intermediate  786 8.00% 11.50% 1.53% 79.01% NA
Temperate Japonica  767 92.60% 4.00% 0.00% 3.39% NA
Tropical Japonica  504 46.20% 42.30% 0.20% 11.31% NA
Japonica Intermediate  241 38.60% 54.80% 0.41% 6.22% NA
VI/Aromatic  96 58.30% 2.10% 4.17% 35.42% NA
Intermediate  90 24.40% 23.30% 3.33% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117997623 A -> T LOC_Os11g30930.1 upstream_gene_variant ; 939.0bp to feature; MODIFIER silent_mutation Average:7.597; most accessible tissue: Callus, score: 28.869 N N N N
vg1117997623 A -> T LOC_Os11g30940.1 upstream_gene_variant ; 709.0bp to feature; MODIFIER silent_mutation Average:7.597; most accessible tissue: Callus, score: 28.869 N N N N
vg1117997623 A -> T LOC_Os11g30920.1 downstream_gene_variant ; 3775.0bp to feature; MODIFIER silent_mutation Average:7.597; most accessible tissue: Callus, score: 28.869 N N N N
vg1117997623 A -> T LOC_Os11g30950.1 downstream_gene_variant ; 4432.0bp to feature; MODIFIER silent_mutation Average:7.597; most accessible tissue: Callus, score: 28.869 N N N N
vg1117997623 A -> T LOC_Os11g30930-LOC_Os11g30940 intergenic_region ; MODIFIER silent_mutation Average:7.597; most accessible tissue: Callus, score: 28.869 N N N N
vg1117997623 A -> DEL N N silent_mutation Average:7.597; most accessible tissue: Callus, score: 28.869 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117997623 NA 1.35E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623 NA 3.07E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623 NA 1.53E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623 NA 6.55E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623 NA 8.36E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623 3.48E-06 3.47E-06 mr1634_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623 NA 2.27E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623 NA 1.62E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251