Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117997623:

Variant ID: vg1117997623 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17997623
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.06, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GGTCCGAAATTTTGAACAAAATTTAGTTGAATTTAAATAAATATTACCCAAATTCATCAAAAAGTTGAAAAATTCAAAAATTTCAGCCGAATTAATATCG[A/T]
ATCGGAGGGACCGAAATGATCGAAATTTCAGAAATTTTGGTCCGAAATTTCCAACCCTGATGCCGCTGGCTTGACCCGCGAGCCGAAGAGCTTGGAAACT

Reverse complement sequence

AGTTTCCAAGCTCTTCGGCTCGCGGGTCAAGCCAGCGGCATCAGGGTTGGAAATTTCGGACCAAAATTTCTGAAATTTCGATCATTTCGGTCCCTCCGAT[T/A]
CGATATTAATTCGGCTGAAATTTTTGAATTTTTCAACTTTTTGATGAATTTGGGTAATATTTATTTAAATTCAACTAAATTTTGTTCAAAATTTCGGACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.10%	16.30%	0.74%	53.81%	NA
All Indica	2759	8.00%	13.40%	0.83%	77.78%	NA
All Japonica	1512	68.50%	24.90%	0.13%	6.48%	NA
Aus	269	15.20%	1.50%	1.12%	82.16%	NA
Indica I	595	18.70%	12.40%	0.67%	68.24%	NA
Indica II	465	2.20%	23.20%	1.29%	73.33%	NA
Indica III	913	4.10%	10.60%	0.11%	85.21%	NA
Indica Intermediate	786	8.00%	11.50%	1.53%	79.01%	NA
Temperate Japonica	767	92.60%	4.00%	0.00%	3.39%	NA
Tropical Japonica	504	46.20%	42.30%	0.20%	11.31%	NA
Japonica Intermediate	241	38.60%	54.80%	0.41%	6.22%	NA
VI/Aromatic	96	58.30%	2.10%	4.17%	35.42%	NA
Intermediate	90	24.40%	23.30%	3.33%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117997623	A -> T	LOC_Os11g30930.1	upstream_gene_variant ; 939.0bp to feature; MODIFIER	silent_mutation	Average:7.597; most accessible tissue: Callus, score: 28.869	N	N	N	N
vg1117997623	A -> T	LOC_Os11g30940.1	upstream_gene_variant ; 709.0bp to feature; MODIFIER	silent_mutation	Average:7.597; most accessible tissue: Callus, score: 28.869	N	N	N	N
vg1117997623	A -> T	LOC_Os11g30920.1	downstream_gene_variant ; 3775.0bp to feature; MODIFIER	silent_mutation	Average:7.597; most accessible tissue: Callus, score: 28.869	N	N	N	N
vg1117997623	A -> T	LOC_Os11g30950.1	downstream_gene_variant ; 4432.0bp to feature; MODIFIER	silent_mutation	Average:7.597; most accessible tissue: Callus, score: 28.869	N	N	N	N
vg1117997623	A -> T	LOC_Os11g30930-LOC_Os11g30940	intergenic_region ; MODIFIER	silent_mutation	Average:7.597; most accessible tissue: Callus, score: 28.869	N	N	N	N
vg1117997623	A -> DEL	N	N	silent_mutation	Average:7.597; most accessible tissue: Callus, score: 28.869	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117997623	NA	1.35E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623	NA	3.07E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623	NA	1.53E-06	mr1417_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623	NA	6.55E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623	NA	8.36E-06	mr1621_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623	3.48E-06	3.47E-06	mr1634_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623	NA	2.27E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997623	NA	1.62E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251