\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117997316:

Variant ID: vg1117997316 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 17997316
Reference Allele: GAAlternative Allele: CA,G
Primary Allele: GASecondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAACAATGTGAACGTCACCCCCTTCTCGTACGGCTTACAAAACTATATATAGTAGATAATAGGAAGACACCTAATAGGAAAGATATGTACTTCTACTA[GA/CA,G]
AAACTAATCATAATATATTGTGGACCCATAATTCAGATCACATATTTAACAGCTAACGCCGGATTCAAGGGAGAATCGCCGTAGCGATGACCAGCACGAG

Reverse complement sequence

CTCGTGCTGGTCATCGCTACGGCGATTCTCCCTTGAATCCGGCGTTAGCTGTTAAATATGTGATCTGAATTATGGGTCCACAATATATTATGATTAGTTT[TC/TG,C]
TAGTAGAAGTACATATCTTTCCTATTAGGTGTCTTCCTATTATCTACTATATATAGTTTTGTAAGCCGTACGAGAAGGGGGTGACGTTCACATTGTTATT

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of CA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 8.20% 0.68% 52.79% G: 0.47%
All Indica  2759 21.30% 0.60% 1.05% 76.44% G: 0.58%
All Japonica  1512 69.50% 23.70% 0.07% 6.42% G: 0.33%
Aus  269 18.20% 1.50% 0.74% 79.55% NA
Indica I  595 32.10% 0.20% 0.50% 67.23% NA
Indica II  465 26.20% 0.00% 0.86% 72.90% NA
Indica III  913 13.10% 1.20% 1.31% 83.13% G: 1.20%
Indica Intermediate  786 19.80% 0.50% 1.27% 77.74% G: 0.64%
Temperate Japonica  767 93.60% 2.30% 0.00% 3.39% G: 0.65%
Tropical Japonica  504 47.00% 41.90% 0.20% 10.91% NA
Japonica Intermediate  241 39.80% 53.50% 0.00% 6.64% NA
VI/Aromatic  96 67.70% 0.00% 0.00% 32.29% NA
Intermediate  90 40.00% 10.00% 0.00% 48.89% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117997316 GA -> CA LOC_Os11g30930.1 upstream_gene_variant ; 632.0bp to feature; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> CA LOC_Os11g30940.1 upstream_gene_variant ; 1016.0bp to feature; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> CA LOC_Os11g30920.1 downstream_gene_variant ; 3468.0bp to feature; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> CA LOC_Os11g30950.1 downstream_gene_variant ; 4739.0bp to feature; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> CA LOC_Os11g30930-LOC_Os11g30940 intergenic_region ; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> DEL N N silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> G LOC_Os11g30930.1 upstream_gene_variant ; 633.0bp to feature; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> G LOC_Os11g30940.1 upstream_gene_variant ; 1015.0bp to feature; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> G LOC_Os11g30920.1 downstream_gene_variant ; 3469.0bp to feature; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> G LOC_Os11g30950.1 downstream_gene_variant ; 4738.0bp to feature; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N
vg1117997316 GA -> G LOC_Os11g30930-LOC_Os11g30940 intergenic_region ; MODIFIER silent_mutation Average:12.496; most accessible tissue: Callus, score: 69.86 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117997316 NA 6.94E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 2.21E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 2.24E-06 6.64E-22 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 2.96E-09 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 9.82E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.95E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 6.41E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 7.89E-07 7.87E-07 mr1286_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 8.06E-07 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 6.21E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.33E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.72E-08 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.43E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 7.31E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 2.29E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 6.47E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 7.65E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 2.30E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 6.20E-11 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 3.22E-09 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 5.33E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 7.36E-12 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 3.06E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 6.64E-07 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.98E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 8.55E-08 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 8.30E-06 9.19E-14 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.91E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 8.37E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.01E-07 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 3.56E-07 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.98E-15 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 3.83E-07 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 6.89E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.13E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 8.37E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 9.02E-06 9.02E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 2.91E-06 4.36E-24 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 1.31E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 5.17E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 3.80E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 NA 6.87E-08 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117997316 6.22E-06 6.21E-06 mr1979_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251