\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117996370:

Variant ID: vg1117996370 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17996370
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCAATAAGTGTCTGTATCTTCGCGAGTACCACATGCCTCGACGCCGTTTCTTACTGCACATCTGGGAGGCACTCCGCGTCCTGTCTCCGTCGTCACCG[C/T]
CAGAATCTCTTGCCTAAGCCTCCCCCACCGCCAGAAACCCCAGAACCCAACCCTCCGCCACCATCATCGCTGCCGCCGCCACCATAACCCAACCATAGAT

Reverse complement sequence

ATCTATGGTTGGGTTATGGTGGCGGCGGCAGCGATGATGGTGGCGGAGGGTTGGGTTCTGGGGTTTCTGGCGGTGGGGGAGGCTTAGGCAAGAGATTCTG[G/A]
CGGTGACGACGGAGACAGGACGCGGAGTGCCTCCCAGATGTGCAGTAAGAAACGGCGTCGAGGCATGTGGTACTCGCGAAGATACAGACACTTATTGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 8.20% 1.38% 51.88% NA
All Indica  2759 22.30% 0.60% 2.17% 74.95% NA
All Japonica  1512 69.80% 23.70% 0.13% 6.35% NA
Aus  269 17.80% 1.50% 0.74% 79.93% NA
Indica I  595 32.80% 0.20% 0.84% 66.22% NA
Indica II  465 26.90% 0.00% 1.94% 71.18% NA
Indica III  913 14.60% 1.20% 2.52% 81.71% NA
Indica Intermediate  786 20.60% 0.50% 2.93% 75.95% NA
Temperate Japonica  767 94.30% 2.30% 0.13% 3.26% NA
Tropical Japonica  504 46.80% 42.10% 0.20% 10.91% NA
Japonica Intermediate  241 39.80% 53.50% 0.00% 6.64% NA
VI/Aromatic  96 68.80% 0.00% 0.00% 31.25% NA
Intermediate  90 41.10% 10.00% 1.11% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117996370 C -> T LOC_Os11g30930.1 stop_gained&splice_region_variant ; p.Trp105*; HIGH stop_gained Average:12.391; most accessible tissue: Callus, score: 29.841 N N N N
vg1117996370 C -> DEL LOC_Os11g30930.1 N frameshift_variant Average:12.391; most accessible tissue: Callus, score: 29.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117996370 NA 2.21E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 5.70E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 3.44E-08 5.17E-25 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 2.96E-09 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 1.15E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 9.82E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 9.80E-08 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 1.93E-07 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 5.26E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 4.72E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 1.73E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 8.95E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 1.89E-09 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 7.65E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 1.24E-06 1.42E-13 mr1502_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 3.22E-09 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 4.02E-06 1.31E-13 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 3.06E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 2.53E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 1.22E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 2.39E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 1.75E-08 2.92E-17 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 1.91E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 7.03E-07 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 1.12E-06 1.32E-17 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 2.51E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 5.74E-08 4.07E-27 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 1.31E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 5.17E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 3.80E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117996370 NA 2.97E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251