\
| Variant ID: vg1117986945 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17986945 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCAATATTTTAAAATAAAGTTTACACCCATTATATATATAGCCATCTATTATCTATCTATTATATACTAAAAGTGGCGCTCTAATAAATTAGAGAAAAT[C/T]
CTACAAACGCTCTCAAGCCACCACGTTACGCTCTAATAAATTATAGAAAATCCTAGAAATTCTAAGAAAAAAGCAAAACATCAACCCCTTGATTTTCACT
AGTGAAAATCAAGGGGTTGATGTTTTGCTTTTTTCTTAGAATTTCTAGGATTTTCTATAATTTATTAGAGCGTAACGTGGTGGCTTGAGAGCGTTTGTAG[G/A]
ATTTTCTCTAATTTATTAGAGCGCCACTTTTAGTATATAATAGATAGATAATAGATGGCTATATATATAATGGGTGTAAACTTTATTTTAAAATATTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.20% | 0.30% | 4.85% | 6.62% | NA |
| All Indica | 2759 | 87.70% | 0.20% | 2.75% | 9.35% | NA |
| All Japonica | 1512 | 89.00% | 0.70% | 7.87% | 2.45% | NA |
| Aus | 269 | 84.80% | 0.00% | 11.15% | 4.09% | NA |
| Indica I | 595 | 90.80% | 0.00% | 2.86% | 6.39% | NA |
| Indica II | 465 | 78.10% | 0.40% | 6.45% | 15.05% | NA |
| Indica III | 913 | 90.50% | 0.00% | 0.77% | 8.76% | NA |
| Indica Intermediate | 786 | 87.90% | 0.40% | 2.80% | 8.91% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 0.91% | 0.91% | NA |
| Tropical Japonica | 504 | 77.40% | 1.60% | 15.48% | 5.56% | NA |
| Japonica Intermediate | 241 | 83.80% | 1.20% | 14.11% | 0.83% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 0.00% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117986945 | C -> T | LOC_Os11g30920.1 | upstream_gene_variant ; 4240.0bp to feature; MODIFIER | silent_mutation | Average:22.477; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg1117986945 | C -> T | LOC_Os11g30910.1 | downstream_gene_variant ; 226.0bp to feature; MODIFIER | silent_mutation | Average:22.477; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg1117986945 | C -> T | LOC_Os11g30910-LOC_Os11g30920 | intergenic_region ; MODIFIER | silent_mutation | Average:22.477; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg1117986945 | C -> DEL | N | N | silent_mutation | Average:22.477; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117986945 | NA | 2.25E-08 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117986945 | NA | 1.79E-07 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117986945 | 2.06E-06 | 3.40E-10 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117986945 | NA | 2.88E-09 | mr1680_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117986945 | NA | 2.19E-09 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117986945 | NA | 5.44E-07 | mr1929_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |