Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117963441:

Variant ID: vg1117963441 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17963441
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CAGGTCAATAATGAACTCTACGTCACGATCTGGTGGCATTCCAGGTAAATCTTCTGGAAACACATCGGGGAATCGCTGTACTACGTGCATTCCTTTCATA[G/C]
GTAGCATGGTGAATATGCCTCCGGCACGTTCGGTCAGTCTAGGATCTTGATCCATAGTTGCCCTCATATCCGATCCCCAGGGTGTGGTCAGGGTAACCTC

Reverse complement sequence

GAGGTTACCCTGACCACACCCTGGGGATCGGATATGAGGGCAACTATGGATCAAGATCCTAGACTGACCGAACGTGCCGGAGGCATATTCACCATGCTAC[C/G]
TATGAAAGGAATGCACGTAGTACAGCGATTCCCCGATGTGTTTCCAGAAGATTTACCTGGAATGCCACCAGATCGTGACGTAGAGTTCATTATTGACCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	3.70%	0.53%	8.34%	NA
All Indica	2759	97.90%	0.30%	0.07%	1.70%	NA
All Japonica	1512	80.30%	1.30%	1.12%	17.33%	NA
Aus	269	31.60%	52.80%	1.86%	13.75%	NA
Indica I	595	97.50%	0.20%	0.00%	2.35%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.50%	0.00%	0.11%	2.41%	NA
Indica Intermediate	786	97.60%	0.90%	0.13%	1.40%	NA
Temperate Japonica	767	96.10%	2.20%	0.13%	1.56%	NA
Tropical Japonica	504	64.50%	0.20%	2.38%	32.94%	NA
Japonica Intermediate	241	63.10%	0.40%	1.66%	34.85%	NA
VI/Aromatic	96	50.00%	3.10%	0.00%	46.88%	NA
Intermediate	90	94.40%	1.10%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117963441	G -> DEL	LOC_Os11g30860.1	N	frameshift_variant	Average:57.803; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg1117963441	G -> C	LOC_Os11g30860.1	missense_variant ; p.Pro376Arg; MODERATE	nonsynonymous_codon ; P376R	Average:57.803; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	probably damaging	2.078	TOLERATED	0.46

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117963441	1.62E-07	2.19E-20	mr1113	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	7.65E-09	1.34E-24	mr1114	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	1.27E-08	7.92E-19	mr1116	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	2.42E-08	1.87E-24	mr1117	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	4.83E-06	2.27E-20	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	2.01E-08	1.51E-26	mr1120	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	8.37E-06	1.73E-24	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	NA	2.24E-18	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	5.74E-06	6.86E-19	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	9.82E-06	1.22E-23	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	NA	8.65E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	1.89E-06	2.75E-16	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	3.69E-08	NA	mr1917	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	NA	1.74E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	5.24E-07	3.64E-24	mr1961	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	1.40E-07	1.35E-19	mr1113_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	3.41E-07	4.76E-18	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	6.29E-07	1.79E-20	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	8.31E-06	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	2.95E-07	1.44E-19	mr1119_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	1.42E-07	2.76E-23	mr1120_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	NA	6.81E-20	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	3.23E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	8.42E-07	3.64E-23	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	NA	3.89E-43	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117963441	5.34E-06	8.61E-17	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251