\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117950562:

Variant ID: vg1117950562 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17950562
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCGAGGTCACAAACCATGTAAATGCAAGCTAATAGCTGACAGGGTGTGAGGATTGGGGCCTGCTCCAGCCGGGGCCTCGGGACACCTATGCCCTACAT[G/A]
GTTGCACACTGTATGTTAAGAGGAGTACGGAGACCTCTAAGATTTATATCTATAAGGTGGAATGGGGCCTGCTCCGGCCGAATCCCTAGGGCACCCAATC

Reverse complement sequence

GATTGGGTGCCCTAGGGATTCGGCCGGAGCAGGCCCCATTCCACCTTATAGATATAAATCTTAGAGGTCTCCGTACTCCTCTTAACATACAGTGTGCAAC[C/T]
ATGTAGGGCATAGGTGTCCCGAGGCCCCGGCTGGAGCAGGCCCCAATCCTCACACCCTGTCAGCTATTAGCTTGCATTTACATGGTTTGTGACCTCGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 1.50% 0.34% 31.19% NA
All Indica  2759 63.10% 0.10% 0.47% 36.32% NA
All Japonica  1512 72.60% 0.30% 0.13% 26.98% NA
Aus  269 85.90% 1.50% 0.37% 12.27% NA
Indica I  595 97.00% 0.00% 0.00% 3.03% NA
Indica II  465 52.00% 0.00% 0.86% 47.10% NA
Indica III  913 48.40% 0.00% 0.66% 50.93% NA
Indica Intermediate  786 61.20% 0.30% 0.38% 38.17% NA
Temperate Japonica  767 97.30% 0.00% 0.00% 2.74% NA
Tropical Japonica  504 49.00% 0.20% 0.20% 50.60% NA
Japonica Intermediate  241 43.20% 1.70% 0.41% 54.77% NA
VI/Aromatic  96 39.60% 55.20% 0.00% 5.21% NA
Intermediate  90 65.60% 5.60% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117950562 G -> A LOC_Os11g30820.1 upstream_gene_variant ; 2171.0bp to feature; MODIFIER silent_mutation Average:79.099; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg1117950562 G -> A LOC_Os11g30830.1 upstream_gene_variant ; 2296.0bp to feature; MODIFIER silent_mutation Average:79.099; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg1117950562 G -> A LOC_Os11g30840.1 downstream_gene_variant ; 3070.0bp to feature; MODIFIER silent_mutation Average:79.099; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg1117950562 G -> A LOC_Os11g30820-LOC_Os11g30830 intergenic_region ; MODIFIER silent_mutation Average:79.099; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N
vg1117950562 G -> DEL N N silent_mutation Average:79.099; most accessible tissue: Zhenshan97 panicle, score: 87.764 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1117950562 G A 0.01 0.01 0.01 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117950562 NA 8.63E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 6.75E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 1.47E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 1.55E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 1.79E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 8.33E-06 1.00E-09 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 3.47E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 1.83E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 7.42E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 1.29E-06 NA mr1471_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 3.29E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 6.04E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 2.02E-06 3.70E-10 mr1642_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 7.44E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 2.60E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 7.72E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117950562 NA 7.74E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251