Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117949081:

Variant ID: vg1117949081 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17949081
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGGCCGAGAAGAATGAAATGAAAAAGGAGAAAATTGGCTATGAGAATAACTCGCACGAAGATGATATATGAGAATAAAATGGATAAGCATATATACTAT[C/A]
TTTGATGCTAAGCACAAGATGTCTTATATATGAAACCAATCAAATTGATGTGGTTAATATGGTAAAGACTAGAGAGTCCATTAATATACCCCTCGGTTAC

Reverse complement sequence

GTAACCGAGGGGTATATTAATGGACTCTCTAGTCTTTACCATATTAACCACATCAATTTGATTGGTTTCATATATAAGACATCTTGTGCTTAGCATCAAA[G/T]
ATAGTATATATGCTTATCCATTTTATTCTCATATATCATCTTCGTGCGAGTTATTCTCATAGCCAATTTTCTCCTTTTTCATTTCATTCTTCTCGGCCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.40%	7.90%	4.38%	18.28%	NA
All Indica	2759	64.90%	0.50%	6.38%	28.27%	NA
All Japonica	1512	72.40%	23.20%	0.53%	3.90%	NA
Aus	269	89.20%	1.50%	6.32%	2.97%	NA
Indica I	595	90.30%	0.00%	1.18%	8.57%	NA
Indica II	465	65.20%	0.00%	4.95%	29.89%	NA
Indica III	913	48.20%	1.10%	11.50%	39.21%	NA
Indica Intermediate	786	64.90%	0.40%	5.22%	29.52%	NA
Temperate Japonica	767	97.00%	2.10%	0.00%	0.91%	NA
Tropical Japonica	504	48.40%	41.50%	0.99%	9.13%	NA
Japonica Intermediate	241	44.00%	52.30%	1.24%	2.49%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	73.30%	6.70%	6.67%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117949081	C -> A	LOC_Os11g30820.1	upstream_gene_variant ; 690.0bp to feature; MODIFIER	silent_mutation	Average:39.753; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1117949081	C -> A	LOC_Os11g30830.1	upstream_gene_variant ; 3777.0bp to feature; MODIFIER	silent_mutation	Average:39.753; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1117949081	C -> A	LOC_Os11g30810.1	downstream_gene_variant ; 3691.0bp to feature; MODIFIER	silent_mutation	Average:39.753; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1117949081	C -> A	LOC_Os11g30840.1	downstream_gene_variant ; 4551.0bp to feature; MODIFIER	silent_mutation	Average:39.753; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1117949081	C -> A	LOC_Os11g30820-LOC_Os11g30830	intergenic_region ; MODIFIER	silent_mutation	Average:39.753; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1117949081	C -> DEL	N	N	silent_mutation	Average:39.753; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117949081	NA	2.20E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	2.91E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	8.76E-08	4.09E-24	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	2.91E-09	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.15E-06	mr1043_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	2.86E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	8.72E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	8.94E-06	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	6.26E-06	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	1.73E-06	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	1.10E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.05E-07	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	9.93E-06	9.91E-06	mr1286_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.44E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.46E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	9.53E-06	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	5.36E-07	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	7.24E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	2.23E-09	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	3.00E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	5.68E-06	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	2.70E-06	2.30E-13	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.83E-09	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	2.01E-06	4.56E-14	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	7.99E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	2.05E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.43E-06	mr1621_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	3.81E-06	mr1621_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.01E-06	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.90E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	6.57E-09	1.41E-17	mr1680_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	2.45E-09	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	3.99E-07	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	8.26E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	4.84E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	5.10E-07	5.70E-18	mr1742_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	3.62E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	2.16E-06	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	7.19E-08	2.96E-26	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.95E-09	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	1.48E-06	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	9.16E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117949081	NA	4.05E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251