\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117907473:

Variant ID: vg1117907473 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17907473
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, G: 0.33, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGTATAGTGTGTCTTTTGGGGGAAGAGATGCAATTTATACCCTTGATGAATCATCTAAAGACTAAAAACAATTGAGGTGATGTAACTTTATGAGAGAG[A/G]
AGAGAATTAGCATTAAATGTACTTAGTGAGGATGAGCTTCGTAGATATATAGTATACATGGAAAGCCATACCATGACATCTCTATCGATCAATAATTGCA

Reverse complement sequence

TGCAATTATTGATCGATAGAGATGTCATGGTATGGCTTTCCATGTATACTATATATCTACGAAGCTCATCCTCACTAAGTACATTTAATGCTAATTCTCT[T/C]
CTCTCTCATAAAGTTACATCACCTCAATTGTTTTTAGTCTTTAGATGATTCATCAAGGGTATAAATTGCATCTCTTCCCCCAAAAGACACACTATACAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.30% 1.60% 10.66% 58.44% NA
All Indica  2759 13.10% 1.10% 7.43% 78.33% NA
All Japonica  1512 59.90% 0.10% 4.89% 35.19% NA
Aus  269 22.30% 0.40% 72.86% 4.46% NA
Indica I  595 19.50% 2.00% 5.21% 73.28% NA
Indica II  465 21.90% 2.20% 2.37% 73.55% NA
Indica III  913 6.00% 0.20% 10.84% 82.91% NA
Indica Intermediate  786 11.30% 0.90% 8.14% 79.64% NA
Temperate Japonica  767 93.40% 0.00% 1.96% 4.69% NA
Tropical Japonica  504 19.20% 0.20% 9.92% 70.63% NA
Japonica Intermediate  241 38.20% 0.00% 3.73% 58.09% NA
VI/Aromatic  96 33.30% 38.50% 21.88% 6.25% NA
Intermediate  90 27.80% 6.70% 8.89% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117907473 A -> DEL N N silent_mutation Average:41.845; most accessible tissue: Callus, score: 74.065 N N N N
vg1117907473 A -> G LOC_Os11g30750.1 upstream_gene_variant ; 4512.0bp to feature; MODIFIER silent_mutation Average:41.845; most accessible tissue: Callus, score: 74.065 N N N N
vg1117907473 A -> G LOC_Os11g30760.1 upstream_gene_variant ; 3573.0bp to feature; MODIFIER silent_mutation Average:41.845; most accessible tissue: Callus, score: 74.065 N N N N
vg1117907473 A -> G LOC_Os11g30760.2 upstream_gene_variant ; 3570.0bp to feature; MODIFIER silent_mutation Average:41.845; most accessible tissue: Callus, score: 74.065 N N N N
vg1117907473 A -> G LOC_Os11g30750-LOC_Os11g30760 intergenic_region ; MODIFIER silent_mutation Average:41.845; most accessible tissue: Callus, score: 74.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117907473 NA 5.91E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 1.33E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 5.88E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 1.11E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 5.96E-06 mr1579 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 6.45E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 1.57E-07 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 4.37E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 9.98E-27 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 3.07E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 2.21E-14 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 2.33E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 6.71E-08 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 5.02E-08 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 3.44E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 1.20E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 2.32E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 3.93E-24 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 2.19E-08 mr1621_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 1.24E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 9.54E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 5.87E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 4.83E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 5.08E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 4.39E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 1.93E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 3.11E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117907473 NA 3.81E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251