\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117845191:

Variant ID: vg1117845191 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17845191
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.50, A: 0.50, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGAATCAACCGAATATCCCTGTATCACATCCTGCAACCAAGCCGGAAAAGAAACTGACAGAGCACACAAAACCGACAATCCATCAGGTACTCTGCGAG[A/T]
TAACGCATCAGTAGCCGCATTGTCCAAACCATGCTTGTAAACAATACGATAGCGTAGACCCAAGAGTTTGGTCAGTGCCTTTTGTTGCCAAGGAGTAGAC

Reverse complement sequence

GTCTACTCCTTGGCAACAAAAGGCACTGACCAAACTCTTGGGTCTACGCTATCGTATTGTTTACAAGCATGGTTTGGACAATGCGGCTACTGATGCGTTA[T/A]
CTCGCAGAGTACCTGATGGATTGTCGGTTTTGTGTGCTCTGTCAGTTTCTTTTCCGGCTTGGTTGCAGGATGTGATACAGGGATATTCGGTTGATTCTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 25.90% 0.25% 15.04% NA
All Indica  2759 60.20% 21.50% 0.33% 17.98% NA
All Japonica  1512 63.80% 34.30% 0.00% 1.92% NA
Aus  269 27.50% 12.30% 0.74% 59.48% NA
Indica I  595 91.80% 4.20% 0.00% 4.03% NA
Indica II  465 28.40% 57.40% 0.65% 13.55% NA
Indica III  913 57.40% 14.30% 0.33% 27.93% NA
Indica Intermediate  786 58.40% 21.60% 0.38% 19.59% NA
Temperate Japonica  767 93.00% 4.60% 0.00% 2.48% NA
Tropical Japonica  504 30.40% 68.50% 0.00% 1.19% NA
Japonica Intermediate  241 40.70% 57.70% 0.00% 1.66% NA
VI/Aromatic  96 38.50% 39.60% 0.00% 21.88% NA
Intermediate  90 50.00% 43.30% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117845191 A -> T LOC_Os11g30650.1 missense_variant ; p.Ser799Thr; MODERATE nonsynonymous_codon ; S799T Average:54.116; most accessible tissue: Callus, score: 76.506 benign 1.359 TOLERATED 0.06
vg1117845191 A -> DEL LOC_Os11g30650.1 N frameshift_variant Average:54.116; most accessible tissue: Callus, score: 76.506 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117845191 NA 6.74E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117845191 NA 8.62E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 3.39E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 3.86E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 3.53E-09 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 8.51E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 1.74E-06 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 8.35E-07 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 1.11E-08 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 3.47E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 9.65E-11 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 5.98E-09 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 1.17E-09 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 6.40E-15 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 5.75E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 5.73E-13 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 9.72E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 4.45E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 1.49E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 1.80E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 3.93E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 3.72E-12 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 6.14E-11 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 2.82E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 4.88E-07 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 1.46E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 3.42E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 6.50E-13 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 2.10E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 6.70E-11 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 2.55E-14 mr1902_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117845191 NA 3.09E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251