\
| Variant ID: vg1117783091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17783091 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGAAGAAAATATAGGGATTAACTCTAAGAAACAATAAAAAAAAGGACCATCTGCACTGCCGCTACCCTCTCTTTAGTCCCGGTTGTTGTTACCAACCGG[G/A]
ACTAAAGATCTATTTTTAGTCTCGGGTATTTGAACCGAGACTAAAGATATCGATCTTTAGTCCCGGATTCGTACTCCCGGTTGGAAAACCAGGACTATAG
CTATAGTCCTGGTTTTCCAACCGGGAGTACGAATCCGGGACTAAAGATCGATATCTTTAGTCTCGGTTCAAATACCCGAGACTAAAAATAGATCTTTAGT[C/T]
CCGGTTGGTAACAACAACCGGGACTAAAGAGAGGGTAGCGGCAGTGCAGATGGTCCTTTTTTTTATTGTTTCTTAGAGTTAATCCCTATATTTTCTTCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 0.90% | 6.24% | 1.38% | NA |
| All Indica | 2759 | 85.70% | 1.40% | 10.51% | 2.36% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.30% | 1.70% | 18.99% | 5.04% | NA |
| Indica II | 465 | 93.10% | 0.60% | 5.38% | 0.86% | NA |
| Indica III | 913 | 88.40% | 1.90% | 8.00% | 1.75% | NA |
| Indica Intermediate | 786 | 86.80% | 1.30% | 10.05% | 1.91% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117783091 | G -> A | LOC_Os11g30560.1 | upstream_gene_variant ; 2047.0bp to feature; MODIFIER | silent_mutation | Average:31.962; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| vg1117783091 | G -> A | LOC_Os11g30552.1 | downstream_gene_variant ; 1999.0bp to feature; MODIFIER | silent_mutation | Average:31.962; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| vg1117783091 | G -> A | LOC_Os11g30552-LOC_Os11g30560 | intergenic_region ; MODIFIER | silent_mutation | Average:31.962; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| vg1117783091 | G -> DEL | N | N | silent_mutation | Average:31.962; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117783091 | 5.89E-06 | NA | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117783091 | 2.28E-06 | NA | mr1491 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |