\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117720843:

Variant ID: vg1117720843 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17720843
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAAAATTAGCTCCTCACCCTTGCACAGATGCAGCCTCTTTTTGCAGTTTTGTTTTGCTGCAAGAAAATTCGGATTTGTTTTGTTGTTGGAAACATTCC[A/G]
AAAAATCCGGTGCGTGAAAACGGCGTGGAGTCCGGATAAGTTACGCGCGACTTATCCGGCTCGGTTACGCAGAGTGGAGATCGTGCAGGCGCCCTGATCA

Reverse complement sequence

TGATCAGGGCGCCTGCACGATCTCCACTCTGCGTAACCGAGCCGGATAAGTCGCGCGTAACTTATCCGGACTCCACGCCGTTTTCACGCACCGGATTTTT[T/C]
GGAATGTTTCCAACAACAAAACAAATCCGAATTTTCTTGCAGCAAAACAAAACTGCAAAAAGAGGCTGCATCTGTGCAAGGGTGAGGAGCTAATTTTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 33.70% 7.91% 3.05% NA
All Indica  2759 72.20% 13.90% 8.92% 5.00% NA
All Japonica  1512 27.10% 72.20% 0.66% 0.07% NA
Aus  269 48.70% 13.40% 37.92% 0.00% NA
Indica I  595 70.30% 20.50% 8.91% 0.34% NA
Indica II  465 57.80% 21.90% 5.59% 14.62% NA
Indica III  913 81.10% 5.60% 10.62% 2.74% NA
Indica Intermediate  786 71.90% 13.70% 8.91% 5.47% NA
Temperate Japonica  767 2.30% 97.50% 0.00% 0.13% NA
Tropical Japonica  504 70.40% 28.80% 0.79% 0.00% NA
Japonica Intermediate  241 14.90% 82.60% 2.49% 0.00% NA
VI/Aromatic  96 41.70% 52.10% 6.25% 0.00% NA
Intermediate  90 46.70% 36.70% 11.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117720843 A -> DEL N N silent_mutation Average:39.684; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg1117720843 A -> G LOC_Os11g30484.1 upstream_gene_variant ; 1237.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg1117720843 A -> G LOC_Os11g30470.1 downstream_gene_variant ; 918.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg1117720843 A -> G LOC_Os11g30470-LOC_Os11g30484 intergenic_region ; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117720843 NA 2.03E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 1.34E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 9.37E-07 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 7.63E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 4.11E-06 4.11E-06 mr1623 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 5.18E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 5.87E-06 4.19E-07 mr1989 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 1.36E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 8.19E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 4.34E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 6.39E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 8.75E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117720843 NA 4.61E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251