\
| Variant ID: vg1117720843 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17720843 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 80. )
CGAAAAATTAGCTCCTCACCCTTGCACAGATGCAGCCTCTTTTTGCAGTTTTGTTTTGCTGCAAGAAAATTCGGATTTGTTTTGTTGTTGGAAACATTCC[A/G]
AAAAATCCGGTGCGTGAAAACGGCGTGGAGTCCGGATAAGTTACGCGCGACTTATCCGGCTCGGTTACGCAGAGTGGAGATCGTGCAGGCGCCCTGATCA
TGATCAGGGCGCCTGCACGATCTCCACTCTGCGTAACCGAGCCGGATAAGTCGCGCGTAACTTATCCGGACTCCACGCCGTTTTCACGCACCGGATTTTT[T/C]
GGAATGTTTCCAACAACAAAACAAATCCGAATTTTCTTGCAGCAAAACAAAACTGCAAAAAGAGGCTGCATCTGTGCAAGGGTGAGGAGCTAATTTTTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.30% | 33.70% | 7.91% | 3.05% | NA |
| All Indica | 2759 | 72.20% | 13.90% | 8.92% | 5.00% | NA |
| All Japonica | 1512 | 27.10% | 72.20% | 0.66% | 0.07% | NA |
| Aus | 269 | 48.70% | 13.40% | 37.92% | 0.00% | NA |
| Indica I | 595 | 70.30% | 20.50% | 8.91% | 0.34% | NA |
| Indica II | 465 | 57.80% | 21.90% | 5.59% | 14.62% | NA |
| Indica III | 913 | 81.10% | 5.60% | 10.62% | 2.74% | NA |
| Indica Intermediate | 786 | 71.90% | 13.70% | 8.91% | 5.47% | NA |
| Temperate Japonica | 767 | 2.30% | 97.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 70.40% | 28.80% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.90% | 82.60% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 52.10% | 6.25% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 36.70% | 11.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117720843 | A -> DEL | N | N | silent_mutation | Average:39.684; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg1117720843 | A -> G | LOC_Os11g30484.1 | upstream_gene_variant ; 1237.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg1117720843 | A -> G | LOC_Os11g30470.1 | downstream_gene_variant ; 918.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg1117720843 | A -> G | LOC_Os11g30470-LOC_Os11g30484 | intergenic_region ; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117720843 | NA | 2.03E-08 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 1.34E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 9.37E-07 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 7.63E-06 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | 4.11E-06 | 4.11E-06 | mr1623 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 5.18E-09 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | 5.87E-06 | 4.19E-07 | mr1989 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 1.36E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 8.19E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 4.34E-06 | mr1359_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 6.39E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 8.75E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117720843 | NA | 4.61E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |